Labshake search
Citations for Lucigen :
51 - 100 of 300 citations for Polybrominated Diphenyl Ether Surrogate Spiking Stock 10X Solution 13C12 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and 0.1 µl Ready-Lyse™ Lysozyme solution (Epicentre) and incubated for 1 hour at 37°C ...
-
bioRxiv - Genetics 2020Quote: DNA was isolated using QuickExtract DNA extract solution (Lucigen) for PCR grade DNA or the QIAamp DNA mini kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA extraction using QuickExtract DNA Extraction Solution (Lucigen) was performed according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... gDNA was extracted using the DNA QuickExtract Solution (Lucigen), followed by PCR and Sanger sequencing to determine efficient mutation rescue.
-
bioRxiv - Biochemistry 2023Quote: ... The CopyControl™ Fosmid autoinduction solution was from Lucigen Corporation (Middleton ...
-
bioRxiv - Biochemistry 2023Quote: ... tissues were lysed in MasterPure tissue lysis solution (EpiCentre) containing 0.2 mg/mL proteinase K (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: QuickExtract DNA Extraction Solution (Lucigen, cat. No. LGN-QE09050)
-
bioRxiv - Genomics 2020Quote: ... Cells were then lysed with QuickExtract DNA Extraction Solution (Lucigen) and PCR-amplified using primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNAs were prepared using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... cellular genomic DNA was extracted using QuickExtract DNA solution (Epicentre) and the Gaac.1826 target locus was PCR amplified and purified using DNA Clean & Concentrator™ (Zymo Research ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen), depending on confluency 25 to 100 μl of solution was added to the wells containing the cells for 15 minutes at 37C ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Cell pellets were lysed using QuickExtract DNA Extraction Solution (Lucigen) following supplier’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... the cell pellet resuspended in 100μL QuickExtract solution (Lucigen #QE09050), transferred to PCR-tubes and incubated in a thermocycler for 15 minutes at 68°C ...
-
bioRxiv - Biochemistry 2020Quote: ... genomic DNA was extracted using Quickextract DNA extraction solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen). PCR amplified target sequence was heated to 95°C and slowly (2C/s ...
-
bioRxiv - Bioengineering 2020Quote: ... genomic DNA was isolated using QuickExtract DNA Extraction Solution (Epicentre). Two sets of PCR primers were designed ...
-
bioRxiv - Developmental Biology 2022Quote: ... Yolk-sac DNA was extracted (QuickExtract DNA Extraction Solution, Epicentre) and used for genotyping to distinguish heterozygous and homozygous Hand2 conditional allele ...
-
bioRxiv - Molecular Biology 2023Quote: ... gDNA was obtained by using QuickExtract DNA Extraction Solution (Lucigen), where 10000 cells were resuspended in 100 μl PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cells were lysed using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was harvested using QuickExtract DNA Extraction Solution (Lucigen), and gDNA was prepared by heating to 65°C for 10 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and genomic DNA was extracted using QuickExtract solution (Lucigen, QE0950).
-
bioRxiv - Microbiology 2023Quote: ... 50 U/μL Ready-Lyse Lysozyme Solution (Lucigen, WI, USA), 2 U/mL Zymolyase (Zymo Research Corporation ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were lysed by QuickExtract™ DNA Extraction Solution (Lucigen) to extract genomic DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using QuickExtract genomic DNA extraction solution (Epicentre Biotechnologies) and then screened by PCR amplification of the region of interest ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies).
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies). C9ORF72 targeting sgRNA1 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was isolated with QuickExtract™ DNA Extraction Solution (Lucigen) and targeted sequences were amplified by PCR ...
-
bioRxiv - Physiology 2022Quote: ... sorted (eGFP+) cells was extracted using QuickExtract DNA Extraction Solution (Lucigen). EnGen Mutation Detection Kit (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were removed by precipitation with MCP solution (Lucigen, WI, USA) and the supernatant was collected after centrifugation at 17,000 x g for 10 min at 40C ...
-
bioRxiv - Cell Biology 2023Quote: ... and genomic DNA were extracted using QuickExtract DNA Extraction Solution (Epicentre). PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... cells were lysed in a Ready-Lyse lysozyme solution (Epicentre Technologies) according to manufacturer’s instructions and lysates were homogenized through QiaShredder columns (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoid DNA was extracted with QuickExtract™ DNA Extraction Solution (Lucigen) and PCR amplified ...
-
bioRxiv - Genetics 2023Quote: ... and extracted genomic DNA with QuickExtract DNA Extraction Solution (QE09050, Lucigen). PCR on the genomic DNA was performed to identify the presence of chromosomes with or without reporter integration56 ...
-
bioRxiv - Genomics 2024Quote: ... and gDNA was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) for PCR screening of targeting vector integration ...
-
bioRxiv - Cancer Biology 2024Quote: ... and gDNA was extracted by using QuickExtract DNA Extraction solution (Epicentre) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen, USA). Genomic PCR was performed using 100 ng genomic DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... HSPCs were harvested and QuickExtract DNA extraction solution (Epicentre, Madison, WI, USA) was used to collect gDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... HSPCs were harvested and QuickExtract DNA extraction solution (Epicentre, Madison, WI, USA) was used to collect gDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... All antibody solutions were supplemented with 0.4U/µl RNase inhibitors (Lucigen, E0126). For smRNA FISH against endogenous transcripts in wild-type CHO cells ...
-
bioRxiv - Neuroscience 2020Quote: DNA was lysed with 50 μl QuickExtract™ DNA Extraction Solution (Lucigen). Copy numbers were analyzed by quantitative real-time PCR performed in an ABI Prism 7900 HT Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... tail samples were lysed in QuickExtract DNA Extra Solution 2.0 (Lucigen, USA) and PCR reactions were carried out with GoTaq DNA polymerase and with the Primers ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was extracted with QuickExtract™ DNA Extraction Solution (Epicentre, QE09050). Genomic PCR was carried out using Q5® High-Fidelity DNA Polymerase (New England Biolabs ...