Labshake search
Citations for Lucigen :
1 - 50 of 274 citations for Nuclear Protein Extraction since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA extraction using QuickExtract DNA Extraction Solution (Lucigen) was performed according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA extraction was performed using QuickExtract™ DNA Extraction Solution (Lucigen), and the genomic locus of interest was amplified using AmpliTaq Gold® 360 Master Mix (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2019Quote: ... DNA extraction was performed using QuickExtract DNA extraction solution (Epicentre, Illumina, Madison, WI) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2022Quote: ... extraction of genomic DNA was performed with QuickExtract™ DNA Extraction Solution (Lucigen) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... Knockout clones were confirmed by genomic DNA extraction using QuickExtract DNA extraction solution (Epicentre), PCR amplification of the target locus (forward primer ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA extraction (Lucigen, Middleton, WI) was performed according to manufacturer’s instructions and gDNA content was quantified using a nanodrop (Thermo-Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Extraction of human genomic DNA was carried out using the QuickExtract DNA Extraction Solution (Lucigen, QE09050) following the standard protocol ...
-
bioRxiv - Molecular Biology 2020Quote: Quick extract DNA extraction solution (Lucigen) was tested in accordance with the manufacturer’s suggested buffer to sample ratio ...
-
bioRxiv - Microbiology 2021Quote: ... and DNA extraction with QuickExtract (EpiCentre) was performed ...
-
bioRxiv - Cell Biology 2023Quote: ... QuickExtract DNA Extraction solution from Lucigen; EDTA-free Complete Protease Cocktail from Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... one set of the duplicated plates was used for genomic DNA extraction using QuickExtract DNA Extraction Solution (Lucigen). 1-2μl of extracted genomic DNA in a total PCR reaction volume of 25μl were amplified in a 35 cycle PCR using a locus-specific primer set (primer set 1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing 30μl QuickExtract DNA Extraction Solution (Lucigen). A full plate containing the reaction mixture (single colony + extraction solution ...
-
bioRxiv - Neuroscience 2023Quote: QuickExtract™ DNA Extraction Solution (QE09050, Lucigen) was used to extract gDNA from the subclones for PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cell debris was then pelleted and used for gDNA extraction with 10-20 µl QuickExtract™ DNA Extraction Solution (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... are listed in Table S3 and RNA extraction was carried out using Master Pure yeast RNA extraction purification kit (Epicentre) from budding cells and cells incubated with serum ...
-
bioRxiv - Cell Biology 2022Quote: ... listed in Table S2 or previously described [89] and RNA extraction was carried out using Master Pure yeast RNA extraction purification kit (Epicentre). All PCR amplified products were confirmed by sequencing (Eurofins MWG Operon ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA was extracted (DNA extraction solution, Epicentre Biotechnologies) and edited regions were specifically amplified by PCR (primers are listed in Supplementary Table 1) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... QuickExtract DNA Extraction Solution was purchased from Lucigen Corporation (WI ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the QuickExtract™ DNA Extraction Solution method (Lucigen), or a salt extraction method (Aljanabi & Martinez ...
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Biochemistry 2022Quote: ... Clones with the best response to TMP were expanded and lysed for gDNA extraction and purification using the QuickExtract DNA extraction solution (Lucigen, Middleton, WI). Genomic ecDHFR was amplified (forward ...
-
bioRxiv - Cell Biology 2019Quote: ... it was extracted (QuickExtract DNA extraction solution, Epicentre Biotechnologies), the region of interest was amplified by PCR (primers described in Supplemental Table 4) ...
-
Weak Membrane Interactions Allow Rheb to Activate mTORC1 Signaling Without Major Lysosome EnrichmentbioRxiv - Cell Biology 2019Quote: ... DNA was extracted (QuickExtract DNA extraction solution; Epicentre Biotechnologies), the region of interest was amplified by PCR (primers summarized in Table S3) ...
-
bioRxiv - Molecular Biology 2023Quote: QuickExtract DNA Extraction Solution (Lucigen, cat. No. LGN-QE09050)
-
bioRxiv - Genomics 2020Quote: ... Cells were then lysed with QuickExtract DNA Extraction Solution (Lucigen) and PCR-amplified using primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNAs were prepared using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen), depending on confluency 25 to 100 μl of solution was added to the wells containing the cells for 15 minutes at 37C ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Cell pellets were lysed using QuickExtract DNA Extraction Solution (Lucigen) following supplier’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... genomic DNA was extracted using Quickextract DNA extraction solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen). PCR amplified target sequence was heated to 95°C and slowly (2C/s ...
-
bioRxiv - Bioengineering 2020Quote: ... genomic DNA was isolated using QuickExtract DNA Extraction Solution (Epicentre). Two sets of PCR primers were designed ...
-
bioRxiv - Developmental Biology 2022Quote: ... Yolk-sac DNA was extracted (QuickExtract DNA Extraction Solution, Epicentre) and used for genotyping to distinguish heterozygous and homozygous Hand2 conditional allele ...
-
bioRxiv - Molecular Biology 2023Quote: ... gDNA was obtained by using QuickExtract DNA Extraction Solution (Lucigen), where 10000 cells were resuspended in 100 μl PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cells were lysed using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was harvested using QuickExtract DNA Extraction Solution (Lucigen), and gDNA was prepared by heating to 65°C for 10 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were lysed by QuickExtract™ DNA Extraction Solution (Lucigen) to extract genomic DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using QuickExtract genomic DNA extraction solution (Epicentre Biotechnologies) and then screened by PCR amplification of the region of interest ...
-
bioRxiv - Developmental Biology 2021Quote: Standard genotyping was performed by DNA extraction with QuickExtract buffer (Lucigen), after ear clipping (pups ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA extraction was done using 10 ul of QuickExtract™ (Lucigen) in a 96 well plate format and the whole fly was used to extract DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... 100,000 iPSCs were taken for DNA extraction using Quick Extract (Lucigen), whereas organoid samples were directly added to Quick Extract (Lucigen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies).
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies). C9ORF72 targeting sgRNA1 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from samples using a MasturePure extraction kit (Lucigen), and 16s rRNA amplicon libraries were prepared with primers 515F and 806R ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was isolated with QuickExtract™ DNA Extraction Solution (Lucigen) and targeted sequences were amplified by PCR ...