Labshake search
Citations for Lucigen :
51 - 100 of 722 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic mapping to mouse GRCm38 and RepeatMasker analysis was performed by Lucigen. Read quality was evaluated by Python Bio.SeqIO56 and FastQC57 ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid Safe DNase kit (EpiCentre) was used to degrade any unspecific recombination products for 30 min at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... ARTseqTM kit from Epicentre (#RPHMR12126); RNaqueous kit from Ambion (#AM1912) ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Genetics 2021Quote: ... Masterpure Yeast RNA purification kit (Epicentre) was used to extract the RNA by following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: AmpliScribe SP6 Transcription Kit (Epicentre AS3106).
-
bioRxiv - Plant Biology 2019Quote: ... Fractions containing few endogenous bacterial proteins were pooled and treated with SUMO Express Protease (Lucigen, WI) at 4°C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA depletion was performed (rRNA depletion Kit Ribo Zero Magnetic Kit for Gram-positive bacteria; Epicentre [Illumina]) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... Ribo-ZeroTM rRNA Removal Kits (Bacteria) and Ribo-ZeroTM Magnetic Gold Kit (Yeast) (Epicentre, San Diego, CA) were used to remove rRNA from the total RNA ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Cell Biology 2021Quote: Total RNAs was treated with RNase R for 30 min at 37°C using 3 U/mg of RNase R (Lucigen, USA). HCC-LM3 and Huh-7 cells treated with actinomycin D (1 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
bioRxiv - Biophysics 2023Quote: ... The 3′ ligation oligo (listed in Supplemental Table S6) was ligated onto the cDNA using CircLigase I (Lucigen #CL4111K, 100 units) with CircLigase Reaction Buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... we pooled all mice into the same tube containing a hypertonic lysis buffer (10mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, 0.1% Igepal, 0.2 U/μl Lucigen NxGen Rnase inhibitor). Nuclei were extracted using a glass dounce homogenizer (DWK ...
-
bioRxiv - Microbiology 2021Quote: ... a combined kit for the ribosomal (rRNA) depletion Ribo-Zero™ Kit (Bacteria) (Epicentre, Illumina, Madison, WI USA) and cDNA library construction kit ...
-
bioRxiv - Genetics 2021Quote: ... ribosomal depleted using Ribo-Zero Kit (Epicentre) and libraries prepared using ScriptSeq v2 RNA-Seq Library Preparation Kit (Epicentre) ...
-
bioRxiv - Systems Biology 2022Quote: ... the ribosomal RNA was depleted by Epicentre Ribo-zero® rRNA Removal Kit (Epicentre). Second ...
-
bioRxiv - Plant Biology 2021Quote: ... A Ribo-Zero magnetic kit (MRZPL116, Epicentre) was used for rRNA depletion from total RNA ...
-
bioRxiv - Immunology 2022Quote: ... ribosomal RNA was removed by Epicentre Ribo-zero™ rRNA Removal Kit (Epicentre) and rRNA-free residue was obtained by ethanol precipitation ...
-
bioRxiv - Microbiology 2022Quote: ATP-Dependent DNase kit (Lucigen, catalog #: E3110K).
-
bioRxiv - Bioengineering 2020Quote: ... using AmpliScribe T7-Flash Transcription Kit (Lucigen) following the manufacturer’s instruction and purified by RNA Clean & Concentrator (Zymo) ...
-
bioRxiv - Genomics 2021Quote: ... and the Globin-Zero Gold kit (Epicentre) to remove globin mRNA and ribosomal RNA ...
-
Multi-omics analysis reveals signatures of selection and loci associated with complex traits in pigsbioRxiv - Genomics 2023Quote: ... Ribosomal RNA was removed by Epicentre Ribo-zeroTM rRNA Removal Kit (Epicentre, USA), and rRNA- free residue was cleaned up by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Poly(A) Polymerase Tailing Kit (Lucigen, UK), Direct RNA Sequencing Kit SQK-RNA002 ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... the 3′ ends of small RNA were ligated to an adapter using T4 truncated RNA ligase (Lucigen, Cat# LR2D11310K and NEB, Cat# M0242L), followed by the ligation of the 5′-end adaptors by T4 ligase ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 μl of the whole cell lysate containing the digested chromatin was taken forward into an overnight blunt end ligation reaction (End-It DNA repair kit and Fast-Link DNA ligation kit, Epicentre) with double stranded DNA adapters at 16°C ...
-
bioRxiv - Genomics 2020Quote: ... The End-It DNA End-Repair Kit (Epicentre) was used to repair DNA fragments to blunt ends ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosomal RNA was removed by Epicentre Ribo-zero™ rRNA Removal Kit (Epicentre, USA), and the libraries have been generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and NxSeq AmpFREE Low DNA Library Kit (Lucigen) was applied ...
-
bioRxiv - Genetics 2022Quote: ... and the MasterPureTM Yeast RNA Purification Kit (Epicentre). cDNAs were synthesized with the FastQuant RT Kit (with gDNase ...
-
bioRxiv - Cell Biology 2021Quote: ... The End-It DNA End-Repair Kit (Epicentre) was used to repair DNA fragments to blunt ends ...
-
bioRxiv - Microbiology 2020Quote: ... or MasterPure Gram Positive DNA purification kit (Lucigen). Sequencing libraries were prepared using NexteraXT (Illumina) ...
-
bioRxiv - Cell Biology 2019Quote: ... using the ScriptSeq kit (Epicentre, CA, USA SS10906). Libraries were amplified via polymerase chain reaction for 12–15 cycles and sequenced in two lanes on the HiSeq 2000 platform at BGI Genome Center (Shenzhen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... repaired with End-IT DNA repair kit (Epicentre), A-tailed with Klenow enzyme (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (ii) Shotgun PCR-free library preparation kit (Lucigen) or (iii ...