Labshake search
Citations for Lucigen :
401 - 450 of 672 citations for Ethinylestradiol EE CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was extracted independently for each specimen using the MasterPure Complete DNA and RNA purification Kit (Epicentre) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... total RNA was subjected to rRNA-depletion using RiboZeroTM rRNA Removal Kit (EpiCentre Inc., Madison, WI, USA). Double stranded cDNA synthesis was performed with rRNA-depleted mRNA using ScriptSeqTM v2 RNA-Seq Library Preparation kit (EpiCentre Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from pure colonies using the MasterPure™Yeast DNA Purification Kit (Epicentre, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... gDNA was directly isolated from conidia stocks using the MasterPure(tm) Yeast DNA Purification Kit (Lucigen/Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... gDNA was directly isolated from conidia stocks using the MasterPure(tm) Yeast DNA Purification Kit (Lucigen/Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and genomic DNA was extracted from them using the MasterPure DNA Purification kit (Epicentre, Madison, WI, USA). Genomic DNA from one additional human iPSC (AG25370 ...
-
bioRxiv - Genetics 2022Quote: ... MTR4 or mtr4-1 cells was isolated using the MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen). Cells were incubated in 2 mL of Leu-minimal medium at 30°C and grown to saturation overnight ...
-
bioRxiv - Genetics 2022Quote: ... MTR4 or mtr4-1 cells was isolated using the MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen). Cells were incubated in 2 mL of Leu-minimal medium at 30°C and grown to saturation overnight ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA from the samples was isolated using MasterPure Complete DNA & RNA Purification Kit (Lucigen, Middleton, WI) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from flies using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen) and converted to cDNA with the PrimeScript RT Master Mix (Takara) ...
-
bioRxiv - Molecular Biology 2022Quote: Ribosomal RNAs (rRNA) were removed using the Epicentre Ribo-zero® rRNA Removal Kit (Epicentre, Madison, WI). For the whole biopsies ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted with the MasterPure™ Complete DNA and RNA Purification Kit (Epicentre, Cat. No.: MC85200). The Qubit 3.0 fluorometer and Nano-300 (Allsheng™ ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DNA of 2 mL overnight culture was extracted with the MasterPure™ Yeast DNA Purification Kit (Lucigen) and whole PCR Tag analysis was performed on population level to test the general presence of all tRNAs within the population (data not shown) ...
-
bioRxiv - Microbiology 2023Quote: ... for raw greywater samples and MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, product code MC85200) for treated greywater samples ...
-
bioRxiv - Immunology 2023Quote: ... cDNA synthesis and strand-specific library generation was carried out using the Script-Seq V2 Kit (Epicentre) and the FailSafe PCR enzyme mix ...
-
bioRxiv - Microbiology 2023Quote: ... ribosomal RNA was removed using the Ribo-Zero rRNA removal kit for Gram-negative bacteria (Epicentre/Illumina), and libraries were prepared with the ScriptSeq Complete kit for bacteria (Epicentre/Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... rRNA depletion from total RNA was performed using the Ribo-Zero magnetic kit (Epicentre Biotechnologies, United States) and the mRNA was chemically fragmented to short pieces (200 nt ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted by using the MasterPure complete DNA and RNA purification kit (Epicentre, Madison, WI) as described by the manufacturer ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted from cell pellets using the MasterPure™ Yeast DNA Purification Kit (Lucigen, cat #MPY80200), with an additional initial incubation with zymolyase at 37°C to enhance cell lysis ...
-
Transcriptional dissection of symptomatic profiles across the brain of men and women with depressionbioRxiv - Neuroscience 2023Quote: ... RNA libraries were synthesized from 1 μg of RNA using the ScriptSeq Complete Gold Kit (Epicentre, Illumina) including an initial ribosomal RNA depletion step ...
-
bioRxiv - Plant Biology 2023Quote: ... the RNA samples were used for library construction using ScriptMiner Small RNA-seq library preparation Kit (Epicentre) and sequencing was performed on an Illumina NextSeq500.
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from concentrated cells using the MasterPure complete DNA and RNA purification kit (Epicentre) and sequenced using P6 chemistry on a RS II instrument (Pacific Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... Linearized plasmids were used for in vitro transcription with the AmpliScribe T7-Flash Transcription Kit (Lucigen, ASF3507) using 5-Methyluridine-5’-Triphosphate (5-mUTP ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA isolation was performed using the Epicentre MasterPure Gram Positive DNA Purification Kit (Lucigen, Middleton, WI, USA) according to manufacturer’s instructions and total gDNA was quantified using a nano-drop (Thermo-Fisher Scientific Waltham ...
-
bioRxiv - Biochemistry 2024Quote: ... washed with water and total cellular RNA was isolated using a MasterPure Yeast RNA Purification Kit (Lucigen) according to the vendor’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... Libraries were prepared using the Lucigen NxSeq AmpFREE Low DNA Library Kit (Catalogue Number: 14000-1, Lucigen), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by the addition of a poly(A) tail using a Poly(A) Polymerase Tailing Kit (Lucigen, PAP5104H). In vitro synthesized capped and poly(A ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al ...
-
bioRxiv - Genomics 2020Quote: ... Bisulfite-converted DNA was used for single-stranded library preparation using the EpiGnome Methyl-Seq kit (Epicentre, EGMK81312) with the described modifications ...
-
bioRxiv - Genomics 2020Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Microbiology 2019Quote: DNA from late log phase cultures of MAH 11 was extracted using a Masterpure DNA Purification kit (Epicentre), prepared using the TruSeq genome DNA sample preparation kit (llumina ...
-
bioRxiv - Genomics 2019Quote: ... The sample was placed on ice and preincubated with the CircLigase II reaction buffer on ice for 5 min (Nuclease-free H2O, 1 × CircLigase buffer, 2.5 mM MnCl2, 0.5 M Betaine, [all included in kit from CL9025K, Epicentre]). After aspiration the CircLigase II reaction mix (same buffer composition as previous but with 1U/µl of CircLigase II enzyme ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA was depleted from 1 µg of total RNA using the Ribo-Zero rRNA Removal Kit (Epicentre) for Plants and Bacteria ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Cell Biology 2021Quote: RNA extraction for wild type and Sts5-2A cells was performed using MasterPure Yeast RNA Purification Kit (Epicentre) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... The dsDNA library was then converted to modified-base RNA using the Durascribe T7 Transcription Kit (Lucigen, MA170E). This kit produces RNA that is resistant to RNase A degradation through the replacement of canonical CTP and UTP with 2’-fluorine-dCTP (2’-F-dCTP ...
-
bioRxiv - Physiology 2021Quote: ... mRNA was purified from 100 ng of total RNA by using a Ribo-Zero rRNA removal kit (Epicentre) to deplete ribosomal RNA and convert into double-stranded complementary DNA by using an NEBNext mRNA Second Strand Synthesis Module (E6111L) ...
-
bioRxiv - Plant Biology 2021Quote: ... complementary RNA (cRNA) was prepared with the AmpliCap-Max™ T7 High Yield Message Maker Kit (Epicentre Biotechnologies). Oocyte preparation and cRNA injection were performed as previously described [94] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al. ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from 2ml of cells at OD595 = 0.8-1.0 using the Masterpure Yeast RNA Purification Kit (Lucigen). Small RNAs were extracted by resuspending 50ml of pelleted cells at OD595 = 0.8-1.0 in 50 mM Tris–HCl pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... genomic DNA from single colonies was extracted with the MasterPureTM DNA Purification Kit from Epicentre (Cat. No. MCD85201) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA for whole genome sequencing was extracted using the MasterPure™ Yeast DNA Purification kit (Lucigen, US) following the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments for blunt cloning were repaired using an End-It DNA End-Repair Kit (Lucigen, cat#ER0720) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was harvested from snap-frozen pellets (using liquid nitrogen) using the MasterPure Yeast RNA Purification Kit (Epicentre) and stored at −80 °C ...
-
bioRxiv - Molecular Biology 2019Quote: In vitro transcribed (IVT) sequences were produced using the Ampliscribe™ T7-Flash™ Transcription Kit (Lucigen-ASF3507), using 1 ug of purified digestion product as starting material ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and size-selection was performed using the Lucigen NxSeq® AMPFree Low DNA Library Kit (Lucigen, Middleton, WI). Libraries were quantified using a Qubit 2.0 instrument (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA was depleted from the sample using the Gram-negative bacteria Ribo-Zero rRNA Removal Kit (Illumina-Epicentre). RNA-seq libraries were prepared with an Illumina TruSeq stranded RNA kit according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Libraries for WGBS were prepared as follows: DNA fragments were end-repaired using the End-It kit (Epicentre), A-tailed with Klenow exo-(NEB ...