Labshake search
Citations for Lucigen :
1 - 50 of 819 citations for Estrone 3 Glucuronide E1G ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were sorted in 5 μl of QuickExtract DNA Extraction Kit (Epicentre, USA) in 96-well format.
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... DNAse-treated RNA (5 µg) was mRNA enriched using a Ribo-Zero Magnetic Kit (Epicentre). After Illumina sequencing the reads were mapped to C ...
-
bioRxiv - Molecular Biology 2019Quote: 5 µg of extracted RNA was depleted from ribosomal RNA using Ribo-Zero Gold Kit (Epicentre Madison). After fragmentation of the rRNA-depleted RNA ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was prepared from 3 mL of turbid liquid culture with the MasterPureTM Gram Positive DNA Purification Kit (Lucigen). DNA was quantified by using a NanodropTM device (Thermo Scientific ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was repaired with Blunt-end ending 3′ overhang using End-It DNA End-Repair kit in 25 µl volume (Epicentre; ER81050), and 3′-A overhang was added with Klenow fragment (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-deadenylase (Epicentre) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2024Quote: ... the 5’PPP structures were removed using RNA 5’ polyphosphatase (Epicentre). Afterwards ...
-
bioRxiv - Developmental Biology 2024Quote: ... ribosomal RNA was removed from 3 μg of total RNA per sample using the Epicentre Ribo-zero™ rRNA Removal Kit (pig; Epicentre, USA). Strand-specific libraries were generated from the rRNA-depleted RNA using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Genomics 2022Quote: ... from at least two freshly starved 9 cm plates of the appropriate worm strain using the MasterPure Complete DNA and RNA Purification kit (Lucigen; cat. #MC85200), following manufacturer protocols ...
-
bioRxiv - Immunology 2019Quote: 1ug of total cellular RNA was treated with RNA 5’ polyphosphatase (enzyme that converts 5’-triphosphorylated RNA into 5’-monophosphorylated RNA, Lucigen) for 30 min at 37°C or mock-treated ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were polyA-tailed and 5’-PPP-ends were trimmed to 5’-P-ends via RNA 5’-polyphosphatase (Epicentre). First-strand cDNA synthesis was performed using an oligo(dT)-adapter and M-MLV reverse transcriptase followed by high-fidelity PCR amplification of the cDNA using primers suitable for Illumina TruSeq sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µg RNA was incubated with 5 U RNase R (#RNR07250; Epicentre) in 1× RNase R buffer (#RNR07250 ...
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Metatranscriptomic libraries were prepared for sequencing with the addition of 5–50 ng of RNA to the ScriptSeq cDNA V2 library preparation kit (Epicentre). Metatranscriptomic samples were sequenced with an Illumina NextSeq 500 system using V2 high output 300 cycle reagent kit with PHIX control added ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-deadenylase (Epicentre, DA11101K) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2023Quote: ... Successful RppH treatment was verified by incubating 100 ng of 5’P or 5’PPP transcripts with 20 U RiboLock and 1 U Terminator™ 5’Phosphate-Dependent Exonuclease (Lucigen) in 1x TEX Buffer B for 30 min at 42°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... by annealing locus-specific oligonucleotides to a common 5’ universal oligonucleotide and performing in vitro RNA transcription (AmpliScribe T7-Flash Kit, Lucigen, ASF3507)40 ...
-
bioRxiv - Bioengineering 2020Quote: The 5′-biotinylated-E07 (anti-EGFR aptamer) was generated by performing an in vitro transcription reaction (DuraScribe T7 Transcription Kit, Lucigen, #DS010925), as described previously (Ray et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... These solutions (5.5 µl each) were then used as template for a 20 µl reaction with the AmpliScribeTM T7 Transcription Kit (Lucigen, AS3107). The reaction product was treated with DNAseI and shRNAs were purified using the RNA Clean and ConcentratorTM Kit (Zymo Reasearch ...
-
bioRxiv - Synthetic Biology 2022Quote: Yeast genomic DNA was prepared from 5 mL stationary phase culture either with the MasterPure™ Yeast DNA Purification Kit (Lucigen) according to the manufacturer guidelines or using the Cetyl Trimethyl Ammonium Bromide (CTAB ...
-
bioRxiv - Biochemistry 2022Quote: ... the CleanNGS elute was adjusted to 25ul with 10mM Tris pH 7.5 and the ends of the digested DNA were repaired and phosphorylated at their 5’ end using the End-It DNA End-repair kit (Lucigen #ER0720). DNA was purified using MinElute PCR Purification Kit (QIAGEN #28006) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were then prepared from 5 ng of DNA by performing end-repair with the End-it DNA End-Repair Kit (Lucigen, ER81050), followed by A tailing with NEB Klenow Fragment (3’−5’ exo- ...
-
bioRxiv - Genetics 2023Quote: ... at least 30 5-FOA resistant clones were grown in YEPD for DNA extraction by MasterPure™ Yeast DNA Purification Kit (Lucigen). The relative location of each chromosome truncation event was determined using multiplex PCR with primers that anneal centromere or telomere proximal to the SiRTA (File S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg of total RNA was treated with the RNA processing enzyme RNA 5′-polyphosphatase (Epicentre) to convert 5′-triphosphate RNA or 5′-diphosphorylated RNA to 5′-monophosphate RNA without dephosphorylating monophosphorylated RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 U RecJ exonuclease (Epicentre). Up to 8 libraries were pooled ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: RNA 5’Polyphosphatase (Lucigen, Middleton, USA) was used to generate 5’p-RNA from IVT 5’ppp-RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl RNase R mixture (Epicentre) was added to the sample before incubation at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 U Baseline-ZERO DNase (Epicentre), 25 U Benzonase (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μl of RNase inhibitor (Lucigen) and 450 μl of IP buffer (150 mM NaCl ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA fragments were poly(A)-tailed and 5’PPP structures were removed with RNA 5’ Polyphosphatase (Epicentre). The RNA sequencing adapter with the barcodes were ligated to the 5’-monophosphate of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... coli 5-alpha Chemically Competent cells (Lucigen), performing a thermal shock for 45 seconds at 42°C followed by 2 minutes on ice ...