Labshake search
Citations for Lucigen :
551 - 600 of 765 citations for Creatinine Serum Low Sample Volume Kit 384 well Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... washed with water and total cellular RNA was isolated using a MasterPure Yeast RNA Purification Kit (Lucigen) according to the vendor’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA isolation was performed using the Epicentre MasterPure Gram Positive DNA Purification Kit (Lucigen, Middleton, WI, USA) according to manufacturer’s instructions and total gDNA was quantified using a nano-drop (Thermo-Fisher Scientific Waltham ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by the addition of a poly(A) tail using a Poly(A) Polymerase Tailing Kit (Lucigen, PAP5104H). In vitro synthesized capped and poly(A ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al ...
-
bioRxiv - Genomics 2020Quote: ... Bisulfite-converted DNA was used for single-stranded library preparation using the EpiGnome Methyl-Seq kit (Epicentre, EGMK81312) with the described modifications ...
-
bioRxiv - Genomics 2020Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Microbiology 2019Quote: DNA from late log phase cultures of MAH 11 was extracted using a Masterpure DNA Purification kit (Epicentre), prepared using the TruSeq genome DNA sample preparation kit (llumina ...
-
bioRxiv - Genomics 2019Quote: ... The sample was placed on ice and preincubated with the CircLigase II reaction buffer on ice for 5 min (Nuclease-free H2O, 1 × CircLigase buffer, 2.5 mM MnCl2, 0.5 M Betaine, [all included in kit from CL9025K, Epicentre]). After aspiration the CircLigase II reaction mix (same buffer composition as previous but with 1U/µl of CircLigase II enzyme ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA was depleted from 1 µg of total RNA using the Ribo-Zero rRNA Removal Kit (Epicentre) for Plants and Bacteria ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Cell Biology 2021Quote: RNA extraction for wild type and Sts5-2A cells was performed using MasterPure Yeast RNA Purification Kit (Epicentre) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... The dsDNA library was then converted to modified-base RNA using the Durascribe T7 Transcription Kit (Lucigen, MA170E). This kit produces RNA that is resistant to RNase A degradation through the replacement of canonical CTP and UTP with 2’-fluorine-dCTP (2’-F-dCTP ...
-
bioRxiv - Physiology 2021Quote: ... mRNA was purified from 100 ng of total RNA by using a Ribo-Zero rRNA removal kit (Epicentre) to deplete ribosomal RNA and convert into double-stranded complementary DNA by using an NEBNext mRNA Second Strand Synthesis Module (E6111L) ...
-
bioRxiv - Plant Biology 2021Quote: ... complementary RNA (cRNA) was prepared with the AmpliCap-Max™ T7 High Yield Message Maker Kit (Epicentre Biotechnologies). Oocyte preparation and cRNA injection were performed as previously described [94] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al. ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from 2ml of cells at OD595 = 0.8-1.0 using the Masterpure Yeast RNA Purification Kit (Lucigen). Small RNAs were extracted by resuspending 50ml of pelleted cells at OD595 = 0.8-1.0 in 50 mM Tris–HCl pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... genomic DNA from single colonies was extracted with the MasterPureTM DNA Purification Kit from Epicentre (Cat. No. MCD85201) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA for whole genome sequencing was extracted using the MasterPure™ Yeast DNA Purification kit (Lucigen, US) following the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments for blunt cloning were repaired using an End-It DNA End-Repair Kit (Lucigen, cat#ER0720) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was harvested from snap-frozen pellets (using liquid nitrogen) using the MasterPure Yeast RNA Purification Kit (Epicentre) and stored at −80 °C ...
-
bioRxiv - Molecular Biology 2019Quote: In vitro transcribed (IVT) sequences were produced using the Ampliscribe™ T7-Flash™ Transcription Kit (Lucigen-ASF3507), using 1 ug of purified digestion product as starting material ...
-
bioRxiv - Genomics 2020Quote: ... Libraries for WGBS were prepared as follows: DNA fragments were end-repaired using the End-It kit (Epicentre), A-tailed with Klenow exo-(NEB ...
-
bioRxiv - Cancer Biology 2019Quote: We removed rRNA from extracted total RNA using a Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA) and then performed library preparation using a NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5µg of total RNA was subjected to rRNA depletion using the RiboZero Human/Mouse/Rat kit (Epicentre Biotechnologies). cDNA was generated from the depleted RNA using random hexamers or custom primers and Superscript III (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500 ng of total RNA were depleted of ribosomal RNA using the Ribo-Zero rRNA removal kit (Epicentre). The resulting RNA was then used for library preparation using the TruSeq small RNA Sample Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... DNA from the cell pellets were extracted using a MasterPure™ DNA Extraction kit (Epicentre®, Madison, USA) according to the manufacturer’s protocol ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... sgRNA was synthesized in vitro as per the suggested protocol using Ampliscribe T7 Flash Transcription kit (Lucigen, USA). 6xHis-Cas9 protein was synthesized as described previously25 ...
-
bioRxiv - Biochemistry 2021Quote: ... Linear PCR products were ligated by blunt-end ligation using the Fast-link DNA ligation kits from Epicentre. 5μl of the ligation reaction were used for the transformation of chemically-competent E ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA fragments were then blunted and phosphorylated using End-It DNA End-Repair Kit (#ER0720; Epicentre). Part of the repaired pool was set apart for cloning of singlet libraries ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon mutagenesis was performed with the EZ-Tn5
Tnp Transposome kit (Epicentre, Illumina, CA, USA) and the insertion site of all mutants was determined via arbitrary PCR (Segev et al ... -
bioRxiv - Microbiology 2020Quote: ... total RNA was subjected to rRNA-depletion using RiboZero™ rRNA Removal Kit (EpiCentre Inc., Madison, WI, USA). Double stranded cDNA synthesis was performed with rRNA-depleted mRNA using ScriptSeq™ v2 RNA-Seq Library Preparation guide (EpiCentre Inc. ...
-
bioRxiv - Genetics 2022Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of RNA was treated with a beta version of Ribo-Zero Magnetic Gold Kit Yeast (Epicentre) to deplete rRNAs ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.5% SDS) and purified by MasterPure Complete DNA and RNA Purification Kit Bulk Reagents (Epicentre, Madison, WI, USA). RNA was prepared by TRizol according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was extracted from yeast pellets using the MasterPure™ Yeast RNA Purification Kit (Lucigen Cat. No. MPY03100) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: High molecular weight genomic DNA was extracted using the MasterPureTM Gram Positive DNA Purification Kit (Epicentre, Lucigen, USA). Cells from two plates were re-suspend in 1.5mL 1X PBS and harvested by centrifugation ...
-
bioRxiv - Microbiology 2023Quote: High molecular weight genomic DNA was extracted using the MasterPureTM Gram Positive DNA Purification Kit (Epicentre, Lucigen, USA). Cells from two plates were re-suspend in 1.5mL 1X PBS and harvested by centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was resuspended in the yeast cell lysis solution from the MasterPure Yeast DNA extraction kit (Epicentre) and DNA was extracted according to the kit procedure.
-
bioRxiv - Molecular Biology 2023Quote: ... mRNA was purified from total RNA after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... a PCR-amplified NLuc gene block was transcribed using AmpliScribe™ T7-Flash Transcription Kit (Lucigen, ASF-3507) following manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNA clean-up and library prep were performed using either the Ribo-Zero(TM) rRNA Removal Kit (Epicentre) with the Illumina Truseq Stranded RNA LT kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... and bacterial DNA was extracted using the MasterPure™ Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... were grown overnight at 37°C with 12.5 µg of chloramphenicol and extracted using a BACMAX DNA purification kit (Epicentre). Then ...
-
bioRxiv - Immunology 2021Quote: ... libraries were constructed from first strand cDNA using ScriptSeqTM v2 RNA-Seq library preparation kit (Epicentre Biotechnologies, Madison, WI). Briefly ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a (modified) CTAB protocol or a rapid desalting method (MasterPure™ Complete DNA and RNA Purification Kit; Lucigen Corporation).
-
bioRxiv - Genomics 2020Quote: ... gDNA for the rest of the strains was extracted using the Masterpure Complete DNA and RNA purification kit (Lucigen) using the protocol for tissue samples ...
-
bioRxiv - Genomics 2020Quote: ... both transcripts were biotin-labeled after in vitro transcription from 1µg linearized pcDNA3.1-LETR1-1 and pcDNA3.1-LETR1-1-antisense plasmids for 1h at 37°C using Ampliscribe T7-flash biotin-RNA kit (Lucigen). Biotinylated LETR1 sense and antisense RNA were then treated with RNase-free DNase I for additional 15min at 37°C ...