Labshake search
Citations for Lucigen :
401 - 450 of 674 citations for Alkaline Phosphatase Colorimetric Activity Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... then gDNA was extracted using the MasterPure Gram Positive DNA Purification kit according to manufacturer’s protocol (Lucigen). Library preparation and sequencing was performed by the Microbial Genome Sequencing Center (MiGS) ...
-
bioRxiv - Genomics 2020Quote: The gDNA used in this study was extracted with the MasterPure™ DNA Purification Kit (Epicentre, USA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was extracted independently for each specimen using the MasterPure Complete DNA and RNA purification Kit (Epicentre) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... total RNA was subjected to rRNA-depletion using RiboZeroTM rRNA Removal Kit (EpiCentre Inc., Madison, WI, USA). Double stranded cDNA synthesis was performed with rRNA-depleted mRNA using ScriptSeqTM v2 RNA-Seq Library Preparation kit (EpiCentre Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from pure colonies using the MasterPure™Yeast DNA Purification Kit (Epicentre, Madison, WI) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... gDNA was directly isolated from conidia stocks using the MasterPure(tm) Yeast DNA Purification Kit (Lucigen/Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... gDNA was directly isolated from conidia stocks using the MasterPure(tm) Yeast DNA Purification Kit (Lucigen/Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and genomic DNA was extracted from them using the MasterPure DNA Purification kit (Epicentre, Madison, WI, USA). Genomic DNA from one additional human iPSC (AG25370 ...
-
bioRxiv - Genetics 2022Quote: ... MTR4 or mtr4-1 cells was isolated using the MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen). Cells were incubated in 2 mL of Leu-minimal medium at 30°C and grown to saturation overnight ...
-
bioRxiv - Genetics 2022Quote: ... MTR4 or mtr4-1 cells was isolated using the MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen). Cells were incubated in 2 mL of Leu-minimal medium at 30°C and grown to saturation overnight ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA from the samples was isolated using MasterPure Complete DNA & RNA Purification Kit (Lucigen, Middleton, WI) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from flies using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen) and converted to cDNA with the PrimeScript RT Master Mix (Takara) ...
-
bioRxiv - Molecular Biology 2022Quote: Ribosomal RNAs (rRNA) were removed using the Epicentre Ribo-zero® rRNA Removal Kit (Epicentre, Madison, WI). For the whole biopsies ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted with the MasterPure™ Complete DNA and RNA Purification Kit (Epicentre, Cat. No.: MC85200). The Qubit 3.0 fluorometer and Nano-300 (Allsheng™ ...
-
bioRxiv - Synthetic Biology 2022Quote: ... DNA of 2 mL overnight culture was extracted with the MasterPure™ Yeast DNA Purification Kit (Lucigen) and whole PCR Tag analysis was performed on population level to test the general presence of all tRNAs within the population (data not shown) ...
-
bioRxiv - Microbiology 2023Quote: ... for raw greywater samples and MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, product code MC85200) for treated greywater samples ...
-
bioRxiv - Immunology 2023Quote: ... cDNA synthesis and strand-specific library generation was carried out using the Script-Seq V2 Kit (Epicentre) and the FailSafe PCR enzyme mix ...
-
bioRxiv - Microbiology 2023Quote: ... ribosomal RNA was removed using the Ribo-Zero rRNA removal kit for Gram-negative bacteria (Epicentre/Illumina), and libraries were prepared with the ScriptSeq Complete kit for bacteria (Epicentre/Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... rRNA depletion from total RNA was performed using the Ribo-Zero magnetic kit (Epicentre Biotechnologies, United States) and the mRNA was chemically fragmented to short pieces (200 nt ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted from cell pellets using the MasterPure™ Yeast DNA Purification Kit (Lucigen, cat #MPY80200), with an additional initial incubation with zymolyase at 37°C to enhance cell lysis ...
-
Transcriptional dissection of symptomatic profiles across the brain of men and women with depressionbioRxiv - Neuroscience 2023Quote: ... RNA libraries were synthesized from 1 μg of RNA using the ScriptSeq Complete Gold Kit (Epicentre, Illumina) including an initial ribosomal RNA depletion step ...
-
bioRxiv - Plant Biology 2023Quote: ... the RNA samples were used for library construction using ScriptMiner Small RNA-seq library preparation Kit (Epicentre) and sequencing was performed on an Illumina NextSeq500.
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA was extracted from concentrated cells using the MasterPure complete DNA and RNA purification kit (Epicentre) and sequenced using P6 chemistry on a RS II instrument (Pacific Biosystems) ...
-
bioRxiv - Genomics 2023Quote: ... Linearized plasmids were used for in vitro transcription with the AmpliScribe T7-Flash Transcription Kit (Lucigen, ASF3507) using 5-Methyluridine-5’-Triphosphate (5-mUTP ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted by using the MasterPure complete DNA and RNA purification kit (Epicentre, Madison, WI) as described by the manufacturer ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... washed with water and total cellular RNA was isolated using a MasterPure Yeast RNA Purification Kit (Lucigen) according to the vendor’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA isolation was performed using the Epicentre MasterPure Gram Positive DNA Purification Kit (Lucigen, Middleton, WI, USA) according to manufacturer’s instructions and total gDNA was quantified using a nano-drop (Thermo-Fisher Scientific Waltham ...
-
bioRxiv - Genetics 2024Quote: ... Libraries were prepared using the Lucigen NxSeq AmpFREE Low DNA Library Kit (Catalogue Number: 14000-1, Lucigen), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by the addition of a poly(A) tail using a Poly(A) Polymerase Tailing Kit (Lucigen, PAP5104H). In vitro synthesized capped and poly(A ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al ...
-
bioRxiv - Genomics 2020Quote: ... Bisulfite-converted DNA was used for single-stranded library preparation using the EpiGnome Methyl-Seq kit (Epicentre, EGMK81312) with the described modifications ...
-
bioRxiv - Genomics 2020Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Microbiology 2019Quote: DNA from late log phase cultures of MAH 11 was extracted using a Masterpure DNA Purification kit (Epicentre), prepared using the TruSeq genome DNA sample preparation kit (llumina ...
-
bioRxiv - Genomics 2019Quote: ... The sample was placed on ice and preincubated with the CircLigase II reaction buffer on ice for 5 min (Nuclease-free H2O, 1 × CircLigase buffer, 2.5 mM MnCl2, 0.5 M Betaine, [all included in kit from CL9025K, Epicentre]). After aspiration the CircLigase II reaction mix (same buffer composition as previous but with 1U/µl of CircLigase II enzyme ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA was depleted from 1 µg of total RNA using the Ribo-Zero rRNA Removal Kit (Epicentre) for Plants and Bacteria ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Cell Biology 2021Quote: RNA extraction for wild type and Sts5-2A cells was performed using MasterPure Yeast RNA Purification Kit (Epicentre) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... The dsDNA library was then converted to modified-base RNA using the Durascribe T7 Transcription Kit (Lucigen, MA170E). This kit produces RNA that is resistant to RNase A degradation through the replacement of canonical CTP and UTP with 2’-fluorine-dCTP (2’-F-dCTP ...
-
bioRxiv - Physiology 2021Quote: ... mRNA was purified from 100 ng of total RNA by using a Ribo-Zero rRNA removal kit (Epicentre) to deplete ribosomal RNA and convert into double-stranded complementary DNA by using an NEBNext mRNA Second Strand Synthesis Module (E6111L) ...
-
bioRxiv - Plant Biology 2021Quote: ... complementary RNA (cRNA) was prepared with the AmpliCap-Max™ T7 High Yield Message Maker Kit (Epicentre Biotechnologies). Oocyte preparation and cRNA injection were performed as previously described [94] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al. ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from 2ml of cells at OD595 = 0.8-1.0 using the Masterpure Yeast RNA Purification Kit (Lucigen). Small RNAs were extracted by resuspending 50ml of pelleted cells at OD595 = 0.8-1.0 in 50 mM Tris–HCl pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... genomic DNA from single colonies was extracted with the MasterPureTM DNA Purification Kit from Epicentre (Cat. No. MCD85201) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA for whole genome sequencing was extracted using the MasterPure™ Yeast DNA Purification kit (Lucigen, US) following the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments for blunt cloning were repaired using an End-It DNA End-Repair Kit (Lucigen, cat#ER0720) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was harvested from snap-frozen pellets (using liquid nitrogen) using the MasterPure Yeast RNA Purification Kit (Epicentre) and stored at −80 °C ...
-
bioRxiv - Molecular Biology 2019Quote: In vitro transcribed (IVT) sequences were produced using the Ampliscribe™ T7-Flash™ Transcription Kit (Lucigen-ASF3507), using 1 ug of purified digestion product as starting material ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and size-selection was performed using the Lucigen NxSeq® AMPFree Low DNA Library Kit (Lucigen, Middleton, WI). Libraries were quantified using a Qubit 2.0 instrument (Life Technologies ...