Labshake search
Citations for Lucigen :
101 - 144 of 144 citations for Adenovirus Type 5 Hexon Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... 10 μg of total RNA of each strain was treated with RNA 5’-Polyphosphatase (Epicentre, Madison, Wisconsin). The dephosphorylated RNAs were self-ligated by T4 RNA ligase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: 5 µg of extracted RNA was depleted from ribosomal RNA using Ribo-Zero Gold Kit (Epicentre Madison). After fragmentation of the rRNA-depleted RNA ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of total RNA were treated by 1MBU of DNAse (BaseLine-Zero™ DNAse, Epicentre, USA) for 20 min at 37°C to remove residual genomic DNA contamination ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Genomics 2022Quote: ... oligonucleotide with or without a 5’phosphate or circularized oligonucleotide) were treated with 1 U Terminator exonuclease (Lucigen) or mock treated in the manufacturer’s Buffer A for 1 h at 37 °C followed by 1 h at 30 °C ...
-
bioRxiv - Microbiology 2022Quote: ... two µg of total RNA were treated with 5 U of RNase R (cat. # RNR07250, Lucigen, Middleton, WI) for 40 min at 37 °C ...
-
bioRxiv - Systems Biology 2019Quote: ... Ligation of the 5’ adapter (P5_phospho_adapter, oligo 39) to the cDNA was performed using CircLigase II (Lucigen, CL9021K) for 6 hours at 60°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: Cells plated on glass coverslips were incubated with 5 µg/mL Brefeldin A (BFA) (Epicentre Biotechnologies, Madison, WI) for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: Ten micrograms of total RNA extracted from cell-samples at OD600 1.2 and 1.8 were treated with 5’-Terminator Dependent Exonuclease (Lucigen, TER51020) as per manufacturer instructions using Buffer A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Circular ssDNA substrate was prepared by circularisation of 5’-32P labelled TK-49 using CircLigase II (Lucigen cat#CL9021K), according to manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 5 min.The successful linearization of ecDNA was verified by verifying its sensitivity to exonucleaseATP-dependent DNase (Lucigen). After treatment with exonuclease ...
-
bioRxiv - Plant Biology 2021Quote: ... both fractions were combined and all subsequent steps performed as previously described (Pfeifer-Sancar et al., 2013) except that the clean-up of RNA 5’-pholyphosphatase (Epicentre)-treated samples was performed by Clean & Concentrator column purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... Metatranscriptomic libraries were prepared for sequencing with the addition of 5–50 ng of RNA to the ScriptSeq cDNA V2 library preparation kit (Epicentre). Metatranscriptomic samples were sequenced with an Illumina NextSeq 500 system using V2 high output 300 cycle reagent kit with PHIX control added ...
-
bioRxiv - Genetics 2019Quote: ... or 2µg (25th and 100th generation samples) of RNA were incubated for 1h at 37°C with 5’ RNA polyphosphatase (Epicentre) at a final concentration of 1U/µl ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs and other uncapped RNA species were depleted from RNA samples using the Terminator™ 5’-Phosphate-Dependent Exonuclease (Lucigen). Following a standard phenol-chloroform-isoamyl precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 µg of total RNA was mixed with 3 µl of diluted ERCC RNA spike-in mix and then digested for 1h at 30°C with 1 unit of Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in 1X Reaction Buffer A containing 10 units of SUPERase-In RNase inhibitor (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: 10ug of Trizol-extracted RNA from mouse cortex and striatum was treated with Terminator 5’-Phosphate dependent exonuclease (Lucigen TER51020) according to manufacturer’s protocol. ...
-
bioRxiv - Microbiology 2023Quote: Tn-5 transposon insertion library was build based on EZ-Tn5™
Tnp transposome system (Lucigen, WI, USA). Competent C ... -
bioRxiv - Molecular Biology 2023Quote: ... 10 μg RNA extracted from the specific tethering assays was incubated in a 20 μl reaction volume with 1 unit of Terminator 5’- phosphate-dependent exonuclease (Epicentre) for 60 min at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Selected clones lacking the expression of protein-of-interest were sequenced to confirm the knockout: cells were resuspended in QuickExtract (Lucigen), incubated at 65 °C for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... by annealing locus-specific oligonucleotides to a common 5’ universal oligonucleotide and performing in vitro RNA transcription (AmpliScribe T7-Flash Kit, Lucigen, ASF3507)40 ...
-
bioRxiv - Bioengineering 2020Quote: The 5′-biotinylated-E07 (anti-EGFR aptamer) was generated by performing an in vitro transcription reaction (DuraScribe T7 Transcription Kit, Lucigen, #DS010925), as described previously (Ray et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The suspension was spun down at 5,000 x g for 5 minutes and the pellet was resuspended in 100 µl of QuickExtract™ DNA Extraction Solution (Lucigen) and 0.1 µl Ready-Lyse™ Lysozyme solution (Epicentre ...
-
bioRxiv - Developmental Biology 2022Quote: ... These solutions (5.5 µl each) were then used as template for a 20 µl reaction with the AmpliScribeTM T7 Transcription Kit (Lucigen, AS3107). The reaction product was treated with DNAseI and shRNAs were purified using the RNA Clean and ConcentratorTM Kit (Zymo Reasearch ...
-
bioRxiv - Synthetic Biology 2022Quote: Yeast genomic DNA was prepared from 5 mL stationary phase culture either with the MasterPure™ Yeast DNA Purification Kit (Lucigen) according to the manufacturer guidelines or using the Cetyl Trimethyl Ammonium Bromide (CTAB ...
-
bioRxiv - Biochemistry 2022Quote: ... the CleanNGS elute was adjusted to 25ul with 10mM Tris pH 7.5 and the ends of the digested DNA were repaired and phosphorylated at their 5’ end using the End-It DNA End-repair kit (Lucigen #ER0720). DNA was purified using MinElute PCR Purification Kit (QIAGEN #28006) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were then prepared from 5 ng of DNA by performing end-repair with the End-it DNA End-Repair Kit (Lucigen, ER81050), followed by A tailing with NEB Klenow Fragment (3’−5’ exo- ...
-
bioRxiv - Genetics 2023Quote: ... at least 30 5-FOA resistant clones were grown in YEPD for DNA extraction by MasterPure™ Yeast DNA Purification Kit (Lucigen). The relative location of each chromosome truncation event was determined using multiplex PCR with primers that anneal centromere or telomere proximal to the SiRTA (File S1) ...
-
bioRxiv - Biochemistry 2024Quote: ... Fragments sized between 30 and 40 kb were isolated as previously described (Tasse et al., 2010) and cloned into pEPIFOS-5 fosmids (Epicentre Technologies). EPI100 E ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI). Remaining steps followed the recommended PureLink Genomic DNA Mini Kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Plant Biology 2020Quote: A BAC library was constructed with pIndigoBAC-5 (Hind III-Cloning Ready) for a heterozygous resistant plant K182 carrying the Rpi-mcq1 followed the instrument (Epicentre, WI, USA). The library is approximately 9× coverage with an average insert size of 85 kb ...
-
bioRxiv - Developmental Biology 2019Quote: ... and was then incubated for 30 min at 37 °C with or without 5 U μg −1 of RNase R (Epicentre Bio-technologies). Reverse transcription was performed using a QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... and approximately 80 µg of RNA in 1 mL volume was digested with 5 U of RNase I (Lucigen Cat#E0067-10D1) for 45 min at 25°C ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI). Remaining steps followed the recommended PureLink Genomic DNA Mini Kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... eDNA was purified from the samples by removing the proteins and RNA using MasterPure Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), and the DNA concentration was measured using NanoVue Plus (GE Healthcare ...