Labshake search
Citations for Lucigen :
1 - 50 of 61 citations for 8 CHLORO 2H CHROMENE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco acid pyrophosphatase (TAP, Epicentre) was added to convert 5′ PPP or capped RNAs to 5′ P RNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were incubated with Tobacco Acid Pyrophosphatase (Epicentre) and washed once with wash buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Free nucleic acids were digested using OmniCleave Endonuclease (Lucigen, USA) for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Purified RNAs were then treated with TAP (Tobacco Acid Pyrophosphatase, Epicentre) to convert 5′ ends of RNA to monophosphate ...
-
bioRxiv - Microbiology 2019Quote: ... DNase-treated RNA was treated with Tobacco Acid Pyrophosphate (TAP) (Epicentre) at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... Nucleic acids were extracted using MasterPure yeast DNA purification kit (Epicentre, MPY80200) according the manufacturer’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... resuspended in 20 µL circularization reaction mix (7.75 mM Tris pH 8, 1x Epicentre CircLigase buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... expanded by 16 electroporations (8 for each half library) into Endura electrocompetent cells (Lucigen), and plated on sixteen 24.5 cm bioassay plates (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Epicentre MasterPure nucleic acid extraction kit (Epicentre, Madison, WI) per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from the Sterivex filters using the Masterpure™ Nucleic Acid Extraction Kit (Epicentre). Six-hundred microliters of Masterpure™ Tissue and Cell Lysis Solution containing recommended quantities of proteinase K were added to each Sterivex filter ...
-
bioRxiv - Molecular Biology 2019Quote: ... and decapped using Tobacco Acid Pyrophosphatase (TAP) enzyme (Epicentre, can be replaced by RppH from NEB) and purified by phenol/chloroform extraction ...
-
bioRxiv - Cell Biology 2021Quote: ... Fungal genomic acid DNA was isolated with the MasterPureTM Yeast DNA Purification Kit (Lucigen, Wisconsin, USA) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... from lysate of the filamentous bacterial fraction acquired by incubation for 8 hours with 10 U/µl Ready-lyse lysozyme (Epicentre). The sequencing library was prepared using the Nextera XT kit and sequenced the same way as for the SAGs.
-
bioRxiv - Cell Biology 2023Quote: The electroporated progenitors were subjected to adipogenic differentiation for 8 days and the genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen). PCR reactions were conducted with 50 ng of genomic DNA and following primer pairs spanning the sgRNA target site in KAPA HiFi HotStart ReadyMix (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... It was then proceeded using RNase R (3 U/μg; Epicentre, Madison, USA) at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... and the 5’P of capped molecules was exposed by treatment with 5 units of Tobacco Acid Pyrophosphatase (Epicentre). RNA samples were ligated with the TIF-seq DNA/ RNA 5oligo cap using T4 RNA ligase 1 (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Developmental Biology 2023Quote: ... We exposed the nucleic acids of each embryo with 5µl of QuickExtract™ DNA Extraction Solution (Lucigen, VWR, Philadelphia, PA), and incubated at 65°C for 15 minutes followed by 2 minutes at 98°C.
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid extraction from blood samples was performed using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, LGC Ltd, Teddington, GB). For metagenomic analysis ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was prepared from 3 mL of turbid liquid culture with the MasterPureTM Gram Positive DNA Purification Kit (Lucigen). DNA was quantified by using a NanodropTM device (Thermo Scientific ...