Labshake search
Citations for Lucigen :
1 - 50 of 188 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... resuspended in 20 µL circularization reaction mix (7.75 mM Tris pH 8, 1x Epicentre CircLigase buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... expanded by 16 electroporations (8 for each half library) into Endura electrocompetent cells (Lucigen), and plated on sixteen 24.5 cm bioassay plates (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Genomics 2019Quote: ... and the 5’P of capped molecules was exposed by treatment with 5 units of Tobacco Acid Pyrophosphatase (Epicentre). RNA samples were ligated with the TIF-seq DNA/ RNA 5oligo cap using T4 RNA ligase 1 (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
bioRxiv - Microbiology 2021Quote: ... from lysate of the filamentous bacterial fraction acquired by incubation for 8 hours with 10 U/µl Ready-lyse lysozyme (Epicentre). The sequencing library was prepared using the Nextera XT kit and sequenced the same way as for the SAGs.
-
bioRxiv - Cell Biology 2023Quote: The electroporated progenitors were subjected to adipogenic differentiation for 8 days and the genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen). PCR reactions were conducted with 50 ng of genomic DNA and following primer pairs spanning the sgRNA target site in KAPA HiFi HotStart ReadyMix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of circularization reaction mix containing 5 units/µL CircLigase II (Lucigen, CL9021K), 1× CircLigase II buffer (Lucigen ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco acid pyrophosphatase (TAP, Epicentre) was added to convert 5′ PPP or capped RNAs to 5′ P RNAs ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were incubated with Tobacco Acid Pyrophosphatase (Epicentre) and washed once with wash buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 µg RNA was digested with 4 U RNase R (Epicentre) in a total reaction volume of 10 µL for 10 minutes at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Free nucleic acids were digested using OmniCleave Endonuclease (Lucigen, USA) for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-deadenylase (Epicentre) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2024Quote: ... the 5’PPP structures were removed using RNA 5’ polyphosphatase (Epicentre). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... Purified RNAs were then treated with TAP (Tobacco Acid Pyrophosphatase, Epicentre) to convert 5′ ends of RNA to monophosphate ...
-
bioRxiv - Microbiology 2019Quote: ... DNase-treated RNA was treated with Tobacco Acid Pyrophosphate (TAP) (Epicentre) at 37°C ...
-
bioRxiv - Immunology 2019Quote: 1ug of total cellular RNA was treated with RNA 5’ polyphosphatase (enzyme that converts 5’-triphosphorylated RNA into 5’-monophosphorylated RNA, Lucigen) for 30 min at 37°C or mock-treated ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were polyA-tailed and 5’-PPP-ends were trimmed to 5’-P-ends via RNA 5’-polyphosphatase (Epicentre). First-strand cDNA synthesis was performed using an oligo(dT)-adapter and M-MLV reverse transcriptase followed by high-fidelity PCR amplification of the cDNA using primers suitable for Illumina TruSeq sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µg RNA was incubated with 5 U RNase R (#RNR07250; Epicentre) in 1× RNase R buffer (#RNR07250 ...
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-deadenylase (Epicentre, DA11101K) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2023Quote: ... Successful RppH treatment was verified by incubating 100 ng of 5’P or 5’PPP transcripts with 20 U RiboLock and 1 U Terminator™ 5’Phosphate-Dependent Exonuclease (Lucigen) in 1x TEX Buffer B for 30 min at 42°C ...
-
bioRxiv - Genomics 2020Quote: ... Nucleic acids were extracted using MasterPure yeast DNA purification kit (Epicentre, MPY80200) according the manufacturer’ instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg of total RNA was treated with the RNA processing enzyme RNA 5′-polyphosphatase (Epicentre) to convert 5′-triphosphate RNA or 5′-diphosphorylated RNA to 5′-monophosphate RNA without dephosphorylating monophosphorylated RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 U RecJ exonuclease (Epicentre). Up to 8 libraries were pooled ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: RNA 5’Polyphosphatase (Lucigen, Middleton, USA) was used to generate 5’p-RNA from IVT 5’ppp-RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl RNase R mixture (Epicentre) was added to the sample before incubation at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 U Baseline-ZERO DNase (Epicentre), 25 U Benzonase (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μl of RNase inhibitor (Lucigen) and 450 μl of IP buffer (150 mM NaCl ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Epicentre MasterPure nucleic acid extraction kit (Epicentre, Madison, WI) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... 4 units of Ampligase® DNA Ligase (Epicentre), 0.2 ul of Ampligase® 10X Reaction Buffer ...
-
bioRxiv - Genomics 2023Quote: ... cloni 10G ELITE Electrocompetent Cells (Lucigen 60052-4) in 1mm cuvette (Bio-Rad 1652089 ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA fragments were poly(A)-tailed and 5’PPP structures were removed with RNA 5’ Polyphosphatase (Epicentre). The RNA sequencing adapter with the barcodes were ligated to the 5’-monophosphate of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... coli 5-alpha Chemically Competent cells (Lucigen), performing a thermal shock for 45 seconds at 42°C followed by 2 minutes on ice ...