Labshake search
Citations for Lucigen :
1 - 50 of 455 citations for 7 CHLORO 4 NITRO 5 PIPERIDINO 2 1 3 BENZOXADIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Genetics 2019Quote: ... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of circularization reaction mix containing 5 units/µL CircLigase II (Lucigen, CL9021K), 1× CircLigase II buffer (Lucigen ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Microbiology 2023Quote: ... Successful RppH treatment was verified by incubating 100 ng of 5’P or 5’PPP transcripts with 20 U RiboLock and 1 U Terminator™ 5’Phosphate-Dependent Exonuclease (Lucigen) in 1x TEX Buffer B for 30 min at 42°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Genomics 2022Quote: ... including a 1:4 ratio of biotin-16-UTP (BU6105H, Lucigen) to UTP at 5 mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Genomics 2022Quote: ... 5 μg RNA were digested with 1 U RNase R (Epicentre) per μg RNA in a total reaction volume of 10 μl for 10 min at 37°C ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and used to electroporate 1-4 tubes of Endura DUO electrocompetent cells (Lucigen) at 1.8 kV distributed over 2 cuvettes (0.1 cm gap width ...
-
bioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
bioRxiv - Microbiology 2023Quote: Tn-5 transposon insertion library was build based on EZ-Tn5™
2>Tnp transposome system (Lucigen, WI, USA). Competent C ... -
bioRxiv - Synthetic Biology 2022Quote: ... and 1.5 μL of 5 U μL-1 Ampligase Thermostable DNA Ligase (Lucigen, USA). Water was added to a total volume of 25 μL ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 µg RNA was digested with 4 U RNase R (Epicentre) in a total reaction volume of 10 µL for 10 minutes at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-deadenylase (Epicentre) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Genomics 2023Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... the 5’PPP structures were removed using RNA 5’ polyphosphatase (Epicentre). Afterwards ...
-
bioRxiv - Biochemistry 2020Quote: ... at 37°C (1 – 2 h) and 1 μl from PCR reaction aliquots were transformed in electrocompetent E.coli Cloni® 10G cells (Lucigen, USA). Colonies were screened by colony PCR and sequenced.
-
bioRxiv - Microbiology 2020Quote: ... end-repaired DNA from PoV-01B (1-2 Kb) were prepared by Lucigen (https://www.lucigen.com/) using the pSMART-HCKan cloning vector (Lucigen,WI ...
-
bioRxiv - Immunology 2019Quote: 1ug of total cellular RNA was treated with RNA 5’ polyphosphatase (enzyme that converts 5’-triphosphorylated RNA into 5’-monophosphorylated RNA, Lucigen) for 30 min at 37°C or mock-treated ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were polyA-tailed and 5’-PPP-ends were trimmed to 5’-P-ends via RNA 5’-polyphosphatase (Epicentre). First-strand cDNA synthesis was performed using an oligo(dT)-adapter and M-MLV reverse transcriptase followed by high-fidelity PCR amplification of the cDNA using primers suitable for Illumina TruSeq sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µg RNA was incubated with 5 U RNase R (#RNR07250; Epicentre) in 1× RNase R buffer (#RNR07250 ...
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-deadenylase (Epicentre, DA11101K) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Genomics 2022Quote: ... oligonucleotide with or without a 5’phosphate or circularized oligonucleotide) were treated with 1 U Terminator exonuclease (Lucigen) or mock treated in the manufacturer’s Buffer A for 1 h at 37 °C followed by 1 h at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 100µl of competent cells was mixed with 1 µl of EZ-Tn5 KAN-2 Tnp Transposome (Epicentre) and electroporated at 1800V ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments in the range of 30-40 kbp were resolved by gel electrophoresis (2 V cm-1 overnight at 4 °C) and recovered from 1% low melting point agarose gel using GELase 50X buffer and GELase enzyme (Epicentre). Nucleic acid fragments were then ligated to the linearized CopyControl pCC2FOS vector following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... coli chromosome was carried out by electroporating 1 μL of the EZ-Tn5
2> Tnp Transposome (Epicentre) in 50 μL of EV18-pkD46 electrocompetent cells ... -
bioRxiv - Neuroscience 2021Quote: ... we electroporated 1 μL of 25 ng/μL of each library into 50 μL bacteria (Lucigen, 60242-2), with ...
-
bioRxiv - Genetics 2021Quote: ... coli (Lucigen, 60242-2) by electroporation (1.8 kV ...
-
bioRxiv - Neuroscience 2022Quote: ... coli (Lucigen 60242-2) using program EC1 on MicroPulser Electroporator (Bio-Rad 1652100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 µg of total RNA was mixed with 3 µl of diluted ERCC RNA spike-in mix and then digested for 1h at 30°C with 1 unit of Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in 1X Reaction Buffer A containing 10 units of SUPERase-In RNase inhibitor (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μg RNA extracted from the specific tethering assays was incubated in a 20 μl reaction volume with 1 unit of Terminator 5’- phosphate-dependent exonuclease (Epicentre) for 60 min at 30°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg of total RNA was treated with the RNA processing enzyme RNA 5′-polyphosphatase (Epicentre) to convert 5′-triphosphate RNA or 5′-diphosphorylated RNA to 5′-monophosphate RNA without dephosphorylating monophosphorylated RNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 uL of eluent was then electroporated into each of 2 tubes of 50 uL Endura electrocompetent cells (Lucigen, Cat#60242-2) as per manufacturer’s instructions ...