Labshake search
Citations for Lucigen :
1 - 50 of 370 citations for 6 P TOLYL IMIDAZO 2 1 B THIAZOLE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Genomics 2019Quote: ... and the 5’P of capped molecules was exposed by treatment with 5 units of Tobacco Acid Pyrophosphatase (Epicentre). RNA samples were ligated with the TIF-seq DNA/ RNA 5oligo cap using T4 RNA ligase 1 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by addition of 6 mL of recovery medium (Lucigen, F98226-1) and incubation at 37 °C for one hour at 280 rpm rotation ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco acid pyrophosphatase (TAP, Epicentre) was added to convert 5′ PPP or capped RNAs to 5′ P RNAs ...
-
bioRxiv - Microbiology 2023Quote: ... Successful RppH treatment was verified by incubating 100 ng of 5’P or 5’PPP transcripts with 20 U RiboLock and 1 U Terminator™ 5’Phosphate-Dependent Exonuclease (Lucigen) in 1x TEX Buffer B for 30 min at 42°C ...
-
bioRxiv - Microbiology 2023Quote: ... unligated 5’-P RNA fragments were removed using terminator exonuclease (TEX, Lucigen), followed by ligation of transcriptional start site (TSS)-specific adaptors.
-
bioRxiv - Synthetic Biology 2022Quote: ... two ncRNA expression cassettes (for barcoded ncRNAs “A” and “B”) from the Marionette plasmids were cloned into pSol-TSF (Lucigen F843213-1) facing in opposite directions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were incubated with Tobacco Acid Pyrophosphatase (Epicentre) and washed once with wash buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Free nucleic acids were digested using OmniCleave Endonuclease (Lucigen, USA) for 30 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... at 37°C (1 – 2 h) and 1 μl from PCR reaction aliquots were transformed in electrocompetent E.coli Cloni® 10G cells (Lucigen, USA). Colonies were screened by colony PCR and sequenced.
-
bioRxiv - Microbiology 2020Quote: ... end-repaired DNA from PoV-01B (1-2 Kb) were prepared by Lucigen (https://www.lucigen.com/) using the pSMART-HCKan cloning vector (Lucigen,WI ...
-
bioRxiv - Microbiology 2021Quote: ... Purified RNAs were then treated with TAP (Tobacco Acid Pyrophosphatase, Epicentre) to convert 5′ ends of RNA to monophosphate ...
-
bioRxiv - Microbiology 2019Quote: ... DNase-treated RNA was treated with Tobacco Acid Pyrophosphate (TAP) (Epicentre) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
bioRxiv - Genomics 2020Quote: ... Nucleic acids were extracted using MasterPure yeast DNA purification kit (Epicentre, MPY80200) according the manufacturer’ instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 100µl of competent cells was mixed with 1 µl of EZ-Tn5 KAN-2 Tnp Transposome (Epicentre) and electroporated at 1800V ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (6 μg) from HG003 Δfur was treated with TAP (Epicentre) for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
bioRxiv - Microbiology 2021Quote: ... coli chromosome was carried out by electroporating 1 μL of the EZ-Tn5
2> Tnp Transposome (Epicentre) in 50 μL of EV18-pkD46 electrocompetent cells ... -
bioRxiv - Neuroscience 2021Quote: ... we electroporated 1 μL of 25 ng/μL of each library into 50 μL bacteria (Lucigen, 60242-2), with ...
-
bioRxiv - Genetics 2021Quote: ... coli (Lucigen, 60242-2) by electroporation (1.8 kV ...
-
bioRxiv - Neuroscience 2022Quote: ... coli (Lucigen 60242-2) using program EC1 on MicroPulser Electroporator (Bio-Rad 1652100 ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were polyA-tailed and 5’-PPP-ends were trimmed to 5’-P-ends via RNA 5’-polyphosphatase (Epicentre). First-strand cDNA synthesis was performed using an oligo(dT)-adapter and M-MLV reverse transcriptase followed by high-fidelity PCR amplification of the cDNA using primers suitable for Illumina TruSeq sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: ... the circularization mixture was combined with 6 μl 10X Plasmid-Safe Buffer (Lucigen), 2 μl Plasmid-Safe Enzyme (Lucigen) ...
-
bioRxiv - Microbiology 2020Quote: ... 6 μl Baseline Zero DNAse (0.1 U/μl, Epicentre Technologies, Madison, WI, USA), 1 μl Benzonase (1 U/μl ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 uL of eluent was then electroporated into each of 2 tubes of 50 uL Endura electrocompetent cells (Lucigen, Cat#60242-2) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... coli (Lucigen, cat. 60242-2) using Bio-Rad MicroPulser Electroporator (cat ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Step 2: Riboshredder RNase (Epicentre) was used in place of RNase A ...
-
bioRxiv - Immunology 2020Quote: ... coli (Lucigen, Cat# 60502-2) over fifty shocks for each library ...
-
bioRxiv - Microbiology 2024Quote: ... 2 (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Epicentre MasterPure nucleic acid extraction kit (Epicentre, Madison, WI) per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... at 37°C (1 – 2 h) and 0.9 μl from the reaction mix were electroporated to E.coli Cloni® 10G cells (Lucigen, USA). Colony PCR and sequencing were used for analysis and verification.
-
bioRxiv - Genomics 2021Quote: ... 1 μl of the Gibson reaction was delivered to 25 μl of electrocompetent EnduraTM cells (Lucigen, cat. no. 60242-2) using Gene Pulser®/MicroPulser™ Electroporation Cuvettes ...
-
bioRxiv - Genomics 2020Quote: ... first strand synthesis was performed by incubating the pucks in 200 μL of reverse transcription solution (Maxima 1x RT Buffer, 1 mM dNTPs, 2 U/μL Lucigen NxGen RNAse inhibitor ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Bioengineering 2020Quote: ... 2’-fluoro (2’-F) modified RNA was synthesized using the DuraScribe T7 transcription kit (Lucigen) as described in the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... and patients A and B healthy and cancer tissue RNAs (500 ng) were incubated with 20 U exonuclease I (Lucigen) and 2 U Baseline-ZERO DNase (Lucigen ...
-
bioRxiv - Developmental Biology 2021Quote: ... In brief, RNA was treated with 20 μl RNase R digestion reaction (2 μg RNA, 1 μl RNase R (Lucigen, #RNR07250), 2 μl 10x RNase R reaction buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... The samples were then pelleted at 500rcf for 10 min at 4C followed by a wash in 10mL of Nuclei Wash & Resuspension Buffer (1X PBS, 1% BSA, 0.2U/ul NxGen RNase inhibitor (Lucigen, 30281-2)) ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from the Sterivex filters using the Masterpure™ Nucleic Acid Extraction Kit (Epicentre). Six-hundred microliters of Masterpure™ Tissue and Cell Lysis Solution containing recommended quantities of proteinase K were added to each Sterivex filter ...