Labshake search
Citations for Lucigen :
1 - 50 of 208 citations for 6 Ethyl N N dimethyl 1H pyrrolo 2 3 b pyridine 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... tissues from secondary GBM (Grade III (n=44), Grade IV (n=23)) and LGG (grade II, n=42) using MasterPure kit (Epicentre). Raw reads from the RNA-seq data were processed using an in-house pipeline that uses STAR for read alignment ...
-
bioRxiv - Molecular Biology 2020Quote: Rolling Cycle Amplification (RCA) was done O/N at 30°C using 0.5 Units/μl Φ29 polymerase (Lucigen, 30221-2). The reaction mixture contained also 1X Φ29 buffer ...
-
bioRxiv - Microbiology 2019Quote: ... Protein purification was accomplished using the pETite N-His vector (Lucigen). PCR primers were designed to amplify products for BT2807 and BT2808 containing all amino acids downstream of the predicted signal peptide sequences ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and His-SUMO-N was inserted into the backbone of pETite-HisSUMO (Lucigen) using NEBuilder HiFi DNA Assembly Master Mix kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Plant Biology 2019Quote: Each ARF DBD was cloned in the pETite N-His SUMO Kan expression vector (Lucigen, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Purified PCR products were ligated into the pETite vector containing an N-terminal His6 tag (Lucigen) and transformed into HI-Control 10G cells ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified products and the linearized N-his pETite vector were transformed in HI-Control10G Chemically Competent Cells (Lucigen) and plated on LB plates supplemented with 50 μg/ml kanamycin (Kan) ...
-
bioRxiv - Plant Biology 2023Quote: ... a modified PET32a vector with an N-terminal His6-SUMO expression tag and SUMO protease cleavage site (Lucigen Corporation). SALTY fusion was expressed in Codon+ BL21 (DE3 ...
-
bioRxiv - Biochemistry 2024Quote: ... encoding residues 21 to 344 which lacks the N-terminal mitochondrial-targeting sequence) was cloned into pSol vector (Lucigen) to generate the pSol-His8-SUMO-MGME1 plasmid ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: DNA from six PVN from each supplemental tactile stimulation group in the repeated room temperature condition and nest temperature condition (total n = 24) was extracted using the Masterpure Complete DNA/RNA Extraction kit (Epicentre) and 300 ng of DNA was used for bisulfite conversion using the Epitect Fast Bisulfite Conversion kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... bromii strain L2-63 and the constructs for Sas6 without the signal peptide were amplified using the primers listed in Table S1 with overhangs complementary to the Expresso T7 Cloning & Expression System N-His pETite vector (Lucigen). The forward primers were engineered to include the 6x His sequence that complemented the vector plus a TEV protease recognition site for later tag removal ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was then incubated at 37 °C for 1 h with 20 U of RNase R (Lucigen, cat n°RNR07250), to remove all the undesired products (i.e linear RNA or concatemer product) ...
-
bioRxiv - Microbiology 2024Quote: ... the amplified DNA was cloned into the pETite N-His vector (Expresso™ T7 cloning and expression system, Lucigen, # 49001-1), resulting in constructs with an N-terminal 6x His tag ...
-
bioRxiv - Biochemistry 2020Quote: ... C-terminally truncated MCM9 constructs (643-900 or 680-900) with GST at the N-terminus were transformed into C43 pLysS (Lucigen, Middleton, WI) and induced with 0.25 mM IPTG at OD600 ~ 0.5 for 4 hours at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... It was then proceeded using RNase R (3 U/μg; Epicentre, Madison, USA) at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was prepared from 3 mL of turbid liquid culture with the MasterPureTM Gram Positive DNA Purification Kit (Lucigen). DNA was quantified by using a NanodropTM device (Thermo Scientific ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Cell Biology 2021Quote: Total RNAs was treated with RNase R for 30 min at 37°C using 3 U/mg of RNase R (Lucigen, USA). HCC-LM3 and Huh-7 cells treated with actinomycin D (1 µg/mL ...
-
bioRxiv - Biophysics 2023Quote: ... The 3′ ligation oligo (listed in Supplemental Table S6) was ligated onto the cDNA using CircLigase I (Lucigen #CL4111K, 100 units) with CircLigase Reaction Buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was repaired with Blunt-end ending 3′ overhang using End-It DNA End-Repair kit in 25 µl volume (Epicentre; ER81050), and 3′-A overhang was added with Klenow fragment (NEB ...