Labshake search
Citations for Lucigen :
51 - 100 of 195 citations for 6 Chloro 3 2 chloroethyl 1H pyrrolo 2 3 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and NxGen RNase Inhibitor (0.2 U/μl; Lucigen, 30281-2). Tissue was then triturated by fire-polished Pasteur pipette (three pipettes of decreasing diameter ...
-
bioRxiv - Microbiology 2021Quote: The EZ-Tn5
2> Tnp transposome (Epicentre Biotechnologies, U.S.A) was introduced into E ... -
bioRxiv - Synthetic Biology 2022Quote: ... coli 10G electrocompetent cells (60080-2, Lucigen, Middleton, WI, US). Cells were selected with appropriate antibiotics on solid and liquid culture ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CAGs-rtTA3 PCRs using EconoTaq PLUS (Lucigen #30033-2). Doxycycline chow (food pellets ...
-
bioRxiv - Genetics 2019Quote: ... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by electroporation into Endura ElectroCompetent Cells (Lucigen, 60242-2) at ∼100x coverage ...
-
bioRxiv - Cell Biology 2023Quote: ... TEV protease 96 or SUMO Express proteinase (Lucigen, 30801-2) was respectively incubated with GST-TEV-tagged G3BP1 proteins and His-SUMO-tagged N proteins at 4°C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2021Quote: ... This sequence was cloned into the pSmart (Lucigen Cat#40041-2) shuttle vector using Gibson assembly (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... Excess linker was degraded by adding 2 μl 10× RecJ buffer (Lucigen), 1 μl RecJ exonuclease (Lucigen) ...
-
bioRxiv - Microbiology 2019Quote: ... subvibrioides ΔdivK mutant using the EZ-Tn5
2> TNP transposome (Epicentre). B ... -
bioRxiv - Genetics 2019Quote: ... 2 ul of Hybridase Thermostable RNase H (Epicenter, Madison, WI: Lucigen H39500) to make 10 ul total and incubated for 30 minutes at 45°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Library (50ng) was electroporated into 25µL Endura electrocompetent cells (60242-2, Lucigen). Cells from eight electroporations were pooled and rescued in 8mL of rescue media for 1hr at 37 ...
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of cells were mixed with EZ-Tn5TM
2> transposome (Lucigen) and incubated on ice for 30 min ... -
bioRxiv - Developmental Biology 2021Quote: ... RNA was amplified (Epicenter TargetAmp 2-Round aRNA Amplification Kit 2.0, Epicentre Biotechnologies), DNase-treated (RapidOut DNA Removal kit ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 10 μl RNase H buffer and 2 μl hybridase thermostable RNase H (Lucigen) preheated to 45° were added ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in PCR master mix (EconoTaq PLUS 2× Master Mix, Lucigen), the DNA was amplified for 15 cycles and purified (QIAGEN) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The remaining DNA was depleted with 2 U of Baseline-ZERO DNase (Epicentre) and ribosomal RNA was depleted using the Ribo-Zero Plant rRNA removal kit (Epicentre) ...
-
bioRxiv - Genomics 2021Quote: ... 2 uL of library ligation was added to 50 uL Endura cells (Lucigen) then electroporated ...
-
bioRxiv - Molecular Biology 2021Quote: ... Competent cells were electroporated with Ez-Tn5
2> transposome (Lucigen, Madison, WI). Cells recovered for 90 minutes at 30 °C and then played on PYE plates supplemented with kanamycin ... -
bioRxiv - Microbiology 2022Quote: ... and electroporated with the Ez-Tn5
2> transposome (Epicentre, Charlotte, North Carolina). Cells recovered at 30°C shaking for 90 minutes ... -
bioRxiv - Molecular Biology 2023Quote: ... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... transposable element insertional mutagenesis using EZ-Tn5™
2> Insertion Kit (Epicentre) and sequencing were performed ... -
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was prepared from 3 mL of turbid liquid culture with the MasterPureTM Gram Positive DNA Purification Kit (Lucigen). DNA was quantified by using a NanodropTM device (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Bioengineering 2022Quote: 2’-Fluoro ssRNA was produced by IVT using the Durascribe T7 IVT kit (Epicentre). Reactions consisted of 0.2-1 μg of purified DNA template per 20 μl reaction ...
-
bioRxiv - Microbiology 2019Quote: ... Transposome mixtures were prepared by mixing the EZ-Tn5
2> transposon from Epicentre Biotechnologies ... -
bioRxiv - Evolutionary Biology 2021Quote: ... sample 2 was treated with 20 U RNase R (Epicentre/Illumina, Cat. No. RNR07250) for 1 h at 37°C to degrade linear RNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation was performed according to manufacturer’s instructions into Endura ElectroCompetent Cells (Lucigen, 60242-2). Dilution of transformed cells and estimation of the number of colony forming units allowed for calculation of plasmid library coverage of around 200x.
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation was performed according to manufacturer’s instructions into Endura ElectroCompetent Cells (Lucigen, 60242-2). Dilution of transformed cells and estimation of the number of colony forming units allowed for calculation of plasmid library coverage ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the assembled library plasmid pool was electroporated into Endura cells (Lucigen, Cat #60242-2) at 50-100 ng/µl ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Cell Biology 2021Quote: Total RNAs was treated with RNase R for 30 min at 37°C using 3 U/mg of RNase R (Lucigen, USA). HCC-LM3 and Huh-7 cells treated with actinomycin D (1 µg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was repaired with Blunt-end ending 3′ overhang using End-It DNA End-Repair kit in 25 µl volume (Epicentre; ER81050), and 3′-A overhang was added with Klenow fragment (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... The 3′ ligation oligo (listed in Supplemental Table S6) was ligated onto the cDNA using CircLigase I (Lucigen #CL4111K, 100 units) with CircLigase Reaction Buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... we pooled all mice into the same tube containing a hypertonic lysis buffer (10mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, 0.1% Igepal, 0.2 U/μl Lucigen NxGen Rnase inhibitor). Nuclei were extracted using a glass dounce homogenizer (DWK ...
-
bioRxiv - Genomics 2019Quote: ... genomic DNA samples (∼2 µg) were end-repaired using the End-it kit from Epicentre Technologies (Madison ...
-
bioRxiv - Microbiology 2021Quote: ... the assembled plasmid pool was used to transform 25μl of electrocompetent bacteria (Lucigen #60242-2) on a Bio-Rad Gene-Pulser 2 electroporation system (Bio-Rad # 1652105 ...