Labshake search
Citations for Lucigen :
1 - 50 of 363 citations for 6 CHLORO 1 2 4 TRIAZOLO 4 3 B PYRIDAZINE 3 THIOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 µg RNA was digested with 4 U RNase R (Epicentre) in a total reaction volume of 10 µL for 10 minutes at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Genomics 2022Quote: ... including a 1:4 ratio of biotin-16-UTP (BU6105H, Lucigen) to UTP at 5 mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Genomics 2021Quote: ... and used to electroporate 1-4 tubes of Endura DUO electrocompetent cells (Lucigen) at 1.8 kV distributed over 2 cuvettes (0.1 cm gap width ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Genomics 2023Quote: ... cloni 10G ELITE Electrocompetent Cells (Lucigen 60052-4) in 1mm cuvette (Bio-Rad 1652089 ...
-
bioRxiv - Genetics 2023Quote: ... 4 units of Ampligase® DNA Ligase (Epicentre), 0.2 ul of Ampligase® 10X Reaction Buffer ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Genomics 2024Quote: ... and lysed using 4 µl Ready-lyse lysozyme (Epicentre) for 20 min at 37°C ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... It was then proceeded using RNase R (3 U/μg; Epicentre, Madison, USA) at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments in the range of 30-40 kbp were resolved by gel electrophoresis (2 V cm-1 overnight at 4 °C) and recovered from 1% low melting point agarose gel using GELase 50X buffer and GELase enzyme (Epicentre). Nucleic acid fragments were then ligated to the linearized CopyControl pCC2FOS vector following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... fragment 4 was subsequently subcloned into a low-copy plasmid pSMART LCAmp (Lucigen) to increase stability ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of circularization reaction mix containing 5 units/µL CircLigase II (Lucigen, CL9021K), 1× CircLigase II buffer (Lucigen ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by addition of 6 mL of recovery medium (Lucigen, F98226-1) and incubation at 37 °C for one hour at 280 rpm rotation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA was extracted by adding 4 volumes of QuickExtract DNA Extraction Solution (Epicentre Cat. # QE09050) to the cells ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA was extracted by adding 4 volumes of QuickExtract DNA Extraction Solution (Epicentre, Cat # QE09050) to the cells ...
-
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was prepared from 3 mL of turbid liquid culture with the MasterPureTM Gram Positive DNA Purification Kit (Lucigen). DNA was quantified by using a NanodropTM device (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of RNA was treated with a beta version of Ribo-Zero Magnetic Gold Kit Yeast (Epicentre) to deplete rRNAs ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Cell Biology 2021Quote: Total RNAs was treated with RNase R for 30 min at 37°C using 3 U/mg of RNase R (Lucigen, USA). HCC-LM3 and Huh-7 cells treated with actinomycin D (1 µg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was repaired with Blunt-end ending 3′ overhang using End-It DNA End-Repair kit in 25 µl volume (Epicentre; ER81050), and 3′-A overhang was added with Klenow fragment (NEB ...