Labshake search
Citations for Lucigen :
51 - 100 of 363 citations for 6 BROMO 3 4 BROMO 2 METHYL PHENYL ISOQUINOLIN 1 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Genomics 2023Quote: ... About 20,000 prepared barcode beads were resuspended in 40 μl enzyme buffer (1 U/μl Fast-Link DNA Ligase (Lucigen, E0077-2-D3), 20% End-It Enzyme Mix (Lucigen ...
-
bioRxiv - Genomics 2022Quote: ... and 2 U Baseline-ZERO DNase (Lucigen) in Baseline-ZERO DNase Buffer for 30 min at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 u/µl NxGen RNase inhibitor (Lucigen), 0.1 u/µl vaccinia capping enzyme (VCE ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/L fosmid autoinduction solution (Epicentre), each plate supplemented with 0.3% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... coli cells (Lucigen, catalog no. 60242-2) at 50–100 ng/ul ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µL TypeOne Restriction Inhibitor (Lucigen, USA) and 0.4 µL transposome ...
-
bioRxiv - Microbiology 2021Quote: ... filled with 1 ml LB supplemented with 25 μg/ml chloramphenicol and 2 µl/ml CopyControl fosmid autoinduction solution (Epicentre Biotechnologies, Cat. No. AIS107F). The plates were grown at 30 °C shaking at 700 RPM for 16 h covered by an AeraSeal gas-permeable sheet (EXCEL Scientific Cat ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... It was then proceeded using RNase R (3 U/μg; Epicentre, Madison, USA) at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... the GeCKOv2 plasmid library with 6 guide RNAs per human gene was propagated in Endura ElectroCompetent cells (Lucigen), and lentivirus stocks were generated by co-transfecting 293T cells with the GeCKOv2 plasmid library ...
-
bioRxiv - Genomics 2021Quote: ... 11 μL purified CUT&Tag-DNA was used in the reaction (11 μL DNA, 2 μL 10 μM Tn5mC-ReplO1 oligo, 2 μL 10× Ampligase buffer (Lucigen), 2 μL dNTP mix (2.5mM each ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 ul per tube was transformed into two tubes of 50 ml of Endura electrocompetent cells (Lucigen, Cat#60242-2) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 μl per tube was transformed into two tubes of 50 μl of Endura electrocompetent cells (Lucigen, Cat#60242-2) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The commercial transposome R6Kγori/KAN-2 from Lucigen kit #TSM08KR was used according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... cloni 10G SUPREME Electrocompetent Cells (Lucigen, #60080-2), in 11 parallel transformations (1 mL each ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.1% NxGen RNAse inhibitor (Lucigen; 30281-2)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated with 2 µL of DNase I (Lucigen) at 37°C for 15 minutes ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Immunology 2021Quote: ... and NxGen Rnase Inhibitor (40U/μL; 30281-2 Lucigen). BD Rhapsody cartridges were super-loaded with 60’000 cells each ...
-
bioRxiv - Genetics 2023Quote: ... cloni 10G SUPREME electrocompetent cells (Lucigen Cat#60080-2) using a MicroPulser Electroporator (BioRad) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... fragment 4 was subsequently subcloned into a low-copy plasmid pSMART LCAmp (Lucigen) to increase stability ...
-
bioRxiv - Microbiology 2019Quote: ... NxSeq DNA sample prep kit 2 (Lucigen, Middleton, WI, USA) was used as per manufacturer’s directions with either NEXTFlex 48 barcodes (BioO ...
-
bioRxiv - Microbiology 2019Quote: ... and electroporated with the Ez-Tn5
2> transposome (Epicentre). Cells were recovered for 90 minutes at 30 °C with shaking ... -
bioRxiv - Neuroscience 2021Quote: ... and NxGen RNase Inhibitor (0.2 U/μl; Lucigen, 30281-2). Tissue was then triturated by fire-polished Pasteur pipette (three pipettes of decreasing diameter ...
-
bioRxiv - Microbiology 2021Quote: The EZ-Tn5
2> Tnp transposome (Epicentre Biotechnologies, U.S.A) was introduced into E ... -
bioRxiv - Synthetic Biology 2022Quote: ... coli 10G electrocompetent cells (60080-2, Lucigen, Middleton, WI, US). Cells were selected with appropriate antibiotics on solid and liquid culture ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CAGs-rtTA3 PCRs using EconoTaq PLUS (Lucigen #30033-2). Doxycycline chow (food pellets ...
-
bioRxiv - Genetics 2019Quote: ... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by electroporation into Endura ElectroCompetent Cells (Lucigen, 60242-2) at ∼100x coverage ...
-
bioRxiv - Cell Biology 2023Quote: ... TEV protease 96 or SUMO Express proteinase (Lucigen, 30801-2) was respectively incubated with GST-TEV-tagged G3BP1 proteins and His-SUMO-tagged N proteins at 4°C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of circularization reaction mix containing 5 units/µL CircLigase II (Lucigen, CL9021K), 1× CircLigase II buffer (Lucigen ...
-
bioRxiv - Cell Biology 2021Quote: ... This sequence was cloned into the pSmart (Lucigen Cat#40041-2) shuttle vector using Gibson assembly (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Genomics 2022Quote: ... and split into 6-well culture for expansion and into lysis buffer for DNA extraction (homemade by GESC, formulation identical to Lucigen Quick-Extract buffer). PCRs were performed with Platinum Superfi II 2x master mix (Thermofisher ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... Excess linker was degraded by adding 2 μl 10× RecJ buffer (Lucigen), 1 μl RecJ exonuclease (Lucigen) ...