Labshake search
Citations for Lucigen :
301 - 350 of 415 citations for 5 Pyrimidinecarboxaldehyde 2 1 1 dimethylethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: Synthetic RNA substrate H4 (34) was radiolabeled at its 5’ end using T4 polynucleotide kinase (Epicentre) and [γ-32P]ATP (Perkin Elmer ...
-
bioRxiv - Plant Biology 2019Quote: ... size-selected DNA fragments (150-350kb) were ligated into HindIII digested vector pIndigoBAC-5 (Epicentre, USA) and transformed into E ...
-
bioRxiv - Molecular Biology 2023Quote: ... and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre, RJ411250), followed by pooling and purification of ligated footprints using an Oligo Clean and Concentrator column (Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: 2’-Fluoro ssRNA was produced by IVT using the Durascribe T7 IVT kit (Epicentre). Reactions consisted of 0.2-1 μg of purified DNA template per 20 μl reaction ...
-
bioRxiv - Microbiology 2019Quote: ... Transposome mixtures were prepared by mixing the EZ-Tn5
2> transposon from Epicentre Biotechnologies ... -
bioRxiv - Evolutionary Biology 2021Quote: ... sample 2 was treated with 20 U RNase R (Epicentre/Illumina, Cat. No. RNR07250) for 1 h at 37°C to degrade linear RNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation was performed according to manufacturer’s instructions into Endura ElectroCompetent Cells (Lucigen, 60242-2). Dilution of transformed cells and estimation of the number of colony forming units allowed for calculation of plasmid library coverage of around 200x.
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation was performed according to manufacturer’s instructions into Endura ElectroCompetent Cells (Lucigen, 60242-2). Dilution of transformed cells and estimation of the number of colony forming units allowed for calculation of plasmid library coverage ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the assembled library plasmid pool was electroporated into Endura cells (Lucigen, Cat #60242-2) at 50-100 ng/µl ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR screening of the colonies was performed using genotyping oligos listed in Supplementary Table 1 using Quick Extract DNA Extraction Solution (Lucigen Catalog Number: QE09050) according to manufacturer’s protocol in a PCR machine and DreamTaq Green Polymerase (Thermo Fisher Scientific Catalog Number ...
-
bioRxiv - Plant Biology 2019Quote: ... First-strand cDNA was synthesised from 1 µg of total RNA using MMLV Reverse Transcriptase 1st-Strand cDNA Synthesis Kit (Epicentre Biotechnologies, Madison, USA) as per manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The purified template was transcribed in vitro at 37 °C for 1 h using Ampliscribe™ T7-Flash™ Transcription kit (Lucigen, Epicentre) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: The purified template was transcribed in vitro at 37 °C for 1 h and 30 min using Ampliscribe™ T7-Flash™ Transcription kit (Lucigen, Epicentre). After DNase treatment at 37 °C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs) was achieved by incubation of the RNA with the Terminator 5’-Phosphate-Dependent Exonuclease (TEX, Lucigen). For this purpose ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 10 μg of total RNA of each strain was treated with RNA 5’-Polyphosphatase (Epicentre, Madison, Wisconsin). The dephosphorylated RNAs were self-ligated by T4 RNA ligase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: 5 µg of extracted RNA was depleted from ribosomal RNA using Ribo-Zero Gold Kit (Epicentre Madison). After fragmentation of the rRNA-depleted RNA ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of total RNA were treated by 1MBU of DNAse (BaseLine-Zero™ DNAse, Epicentre, USA) for 20 min at 37°C to remove residual genomic DNA contamination ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2019Quote: ... genomic DNA samples (∼2 µg) were end-repaired using the End-it kit from Epicentre Technologies (Madison ...
-
bioRxiv - Microbiology 2021Quote: ... the assembled plasmid pool was used to transform 25μl of electrocompetent bacteria (Lucigen #60242-2) on a Bio-Rad Gene-Pulser 2 electroporation system (Bio-Rad # 1652105 ...
-
bioRxiv - Microbiology 2020Quote: Random knockout mutants were produced using the EZ::Tn5Tm
2> Tnp TransposomeTm kit (Epicentre) following the manufacturers recommendations ... -
bioRxiv - Cancer Biology 2022Quote: ... The library was transformed into electrocompetent Lucigen Endura™ Escherichia coli (Lucigen; cat. 60242-2) using a Bio-Rad MicroPulser Electroporator (#1652100) ...
-
bioRxiv - Molecular Biology 2020Quote: Transposon mutant libraries were constructed using the EZ-Tn5
2>TnP Transposome Kit (Epicentre) according to the manufacturer’s instructions ... -
bioRxiv - Microbiology 2022Quote: ... Enteritidis strains P125109 and D7795 using the EZ-Tn5™
2> Insertion Kit (Lucigen) as previously described [31] ... -
bioRxiv - Molecular Biology 2023Quote: ... we utilized the ScriptCap m7G Capping System and ScriptCap 2’-O-methyltransferase kit (Epicentre Biotechnologies) with [α-32P] GTP for our experiments ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Microbiology 2022Quote: ... two µg of total RNA were treated with 5 U of RNase R (cat. # RNR07250, Lucigen, Middleton, WI) for 40 min at 37 °C ...
-
bioRxiv - Systems Biology 2019Quote: ... Ligation of the 5’ adapter (P5_phospho_adapter, oligo 39) to the cDNA was performed using CircLigase II (Lucigen, CL9021K) for 6 hours at 60°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2023Quote: Cells plated on glass coverslips were incubated with 5 µg/mL Brefeldin A (BFA) (Epicentre Biotechnologies, Madison, WI) for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... Pellets were resuspended in 2 µl water and subjected to electroporation into Endura competent cells (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and in vitro amplified using a TargetAmp 2-round aRNA Amplification Kit 2.0 (Epicentre, Madison, WI). RNA-seq libraries were constructed using a TruSeq Stranded mRNA Library Prep Kit and quantified on an Agilent bioanalyzer (Agilent ...
-
bioRxiv - Microbiology 2019Quote: ... One μl of the EZ-Tn5
2> Tnp transposome complex (Epicentre BioTechnologies, Madison, WI, USA) was added to electrocompetent S ... -
bioRxiv - Immunology 2021Quote: ... 40 nanograms of each library were transformed into Endura™ ElectroCompetent Cells (Lucigen cat 60242-2) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the pBA439_UMI20 library was electroporated into 25 μl of Lucigen Endura ElectroCompetent Cells (Lucigen, 60242-2) using prechilled 1 mm electroporation cuvettes (BioRad ...
-
bioRxiv - Microbiology 2023Quote: Transposon library of Salmonella was generated using EZ-Tn5
2>Tnp Transposome kit (Lucigen, TSM99K2) following manufacturer’s instructions ... -
bioRxiv - Molecular Biology 2023Quote: ... 20 mg of RNA (∼2 ml sample) was digested with 62.5 units of RNase I (Epicentre) at 4°C for 1 hr ...
-
bioRxiv - Microbiology 2024Quote: A transposon mutant library in pJBG007 was made using EZ-Tn5
2> Insertion Kit (Lucigen). The following components were used for a 10µl reaction (EZ-Tn5 10X Reaction Buffer (1µl ... -
bioRxiv - Microbiology 2020Quote: ... The samples were chilled on ice for 5 minutes and 175 μl of MPC protein precipitation solution (Lucigen, USA) was added to 300 μl of the lysed sample and vortexed vigorously for 10 seconds ...
-
bioRxiv - Molecular Biology 2019Quote: Proteinase K sensitivity experiments were performed using 1.5ug (protein) of gradient-purified EVs treated with 5 ug /mL Proteinase K (Epicentre) in the absence or presence of 0.05% Triton X-100 at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: Ten micrograms of total RNA extracted from cell-samples at OD600 1.2 and 1.8 were treated with 5’-Terminator Dependent Exonuclease (Lucigen, TER51020) as per manufacturer instructions using Buffer A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Circular ssDNA substrate was prepared by circularisation of 5’-32P labelled TK-49 using CircLigase II (Lucigen cat#CL9021K), according to manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 5 min.The successful linearization of ecDNA was verified by verifying its sensitivity to exonucleaseATP-dependent DNase (Lucigen). After treatment with exonuclease ...
-
bioRxiv - Cell Biology 2020Quote: ... maltophilia transposon insertion mutant library was constructed using an EZ::TN
2> Tnp transposome kit (Epicentre) as described previously and in accordance with the manufacturer’s protocol (Weisenfeld ... -
bioRxiv - Microbiology 2019Quote: ... were used to amplify lnt that had been disrupted by the insertion of Tn5
2> (Epicentre) [6] ...