Labshake search
Citations for Lucigen :
1 - 50 of 57 citations for 5α CHOLESTAN 3 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and Type One Inhibitor (Lucigen), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... with one half being treated with Terminator exonuclease (+TEX, Epicentre), while the other one was left untreated (-TEX) ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was extracted from one plate using QuickExtract DNA extraction solution (Epicentre) to perform genotyping by PCR using primer pairs specifically recognizing the mutated sequences introduced by the ssODN and a genomic sequence adjacent to the region of integration ...
-
bioRxiv - Systems Biology 2023Quote: ... and recovered for one hour at 37°C in Recovery Media (Lucigen). Aliquots from the transformations were used to inoculate overnight cultures of LB containing 25 μg/mL of Zeocin (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... One microliter of the reaction mix was used to transform ultra-competent EPI300 cells (Epicentre). Telomere-positive clones were identified by colony blotting.
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Microbiology 2019Quote: ... One μl of the EZ-Tn5
Tnp transposome complex (Epicentre BioTechnologies, Madison, WI, USA) was added to electrocompetent S ... -
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Microbiology 2023Quote: One swab each was stored in 350 μl Tissue and Cell lysis solution (Lucigen, #MTC096H, Middleton, WI) lysis buffer with 100 μl glass beads (0.1 diameter ...
-
bioRxiv - Cancer Biology 2019Quote: ... one set of the duplicated plates was used for genomic DNA extraction using QuickExtract DNA Extraction Solution (Lucigen). 1-2μl of extracted genomic DNA in a total PCR reaction volume of 25μl were amplified in a 35 cycle PCR using a locus-specific primer set (primer set 1 ...
-
bioRxiv - Genomics 2019Quote: ... Library #3 was amplified using pyrophage polymerase (Lucigen, Middleton, WI).
-
bioRxiv - Molecular Biology 2023Quote: ... and 3’ ends were dephosphorylated with T4 polynucleotide kinase (Lucigen). Between 50 and 75 ng were retrotranscribed in cDNA with 1.5 µL of template-switching TGIRT enzyme ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... and aliquots of 100 μL were dispensed into 0.1 mm gapped electroporation cuvettes along with 1 μg of plasmid DNA and 1 μL of Type-One restriction inhibitor (Epicentre). Electroporation was performed with a Bio-Rad Micropulser (Ec3 pulse ...
-
bioRxiv - Microbiology 2021Quote: ... culture media (Lab M) and the other one into a microfuge tube containing 350 μL Tissue and Cell Lysis buffer (Epicentre) and 100 μg 0.1 mm zirconia beads (BioSpec Products ...
-
bioRxiv - Microbiology 2020Quote: Samples were analyzed directly or mixed 1:1 with one of the following buffers: Quick Extract DNA Extraction Solution (Lucigen), Virotype Tissue Lysis Reagent (INDICAL BIOSCIENCE GmbH ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells from each of these 4 wells were dissociated and divided into 2 portions–one portion was used to collect genomic DNA using QuickExtract DNA Extraction solution (Lucigen) while 500 cells from the other portion was suspended in 25 ml of culture medium and 100 ul was seeded into each well of two 96-well plates for further culture ...
-
bioRxiv - Molecular Biology 2019Quote: One microgram of total RNA was rRNA depleted using the Ribo-Zero rRNA Removal Kit (Human, Mouse, Rat) (Epicentre, Madison, WI, USA) followed by a purification step using AMPure XP Beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to tubes containing 3 μL of lysis buffer (Epicentre, MessageBOOSTER kit). Cells were collected within 1 h of removal from the incubator and within 4 h of removal from the animals.
-
bioRxiv - Biochemistry 2019Quote: ... the dissolved cDNA was mixed with 3 μl of 10x CircLigase Buffer (Epicentre), 1.5 μl of 50 mM MnCl2 ...
-
bioRxiv - Plant Biology 2022Quote: ... It was then proceeded using RNase R (3 U/μg; Epicentre, Madison, USA) at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Complete cDNAs were sequence-amplified by PCR using KOD One™ PCR Master Mix -Blue- (TOYOBO, Japan) and were cloned into pSMART-LCK plasmid (Lucigen, Middleton, WI, USA) containing a T7 RNA polymerase promoter ...
-
bioRxiv - Microbiology 2022Quote: ... Swabs were incubated for one hour at 37°C with shaking in 300μL yeast cell lysis solution (from Lucigen MasterPure Yeast DNA Purification kit) and 10,000 units of ReadyLyse Lysozyme solution (Lucigen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was prepared from 3 mL of turbid liquid culture with the MasterPureTM Gram Positive DNA Purification Kit (Lucigen). DNA was quantified by using a NanodropTM device (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Cell Biology 2021Quote: Total RNAs was treated with RNase R for 30 min at 37°C using 3 U/mg of RNase R (Lucigen, USA). HCC-LM3 and Huh-7 cells treated with actinomycin D (1 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...