Labshake search
Citations for Lucigen :
251 - 300 of 734 citations for DNA Sequencer since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Microbiology 2023Quote: High molecular weight genomic DNA was extracted using the MasterPureTM Gram Positive DNA Purification Kit (Epicentre, Lucigen, USA). Cells from two plates were re-suspend in 1.5mL 1X PBS and harvested by centrifugation ...
-
bioRxiv - Microbiology 2023Quote: High molecular weight genomic DNA was extracted using the MasterPureTM Gram Positive DNA Purification Kit (Epicentre, Lucigen, USA). Cells from two plates were re-suspend in 1.5mL 1X PBS and harvested by centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... and bacterial DNA was extracted using the MasterPure™ Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... genomic DNA was harvested using QuickExtract (Lucigen), and was saved until library preparation and sequencing.
-
bioRxiv - Biophysics 2020Quote: ... genomic DNA was isolated using QuickExtract (Lucigen), the sgRNA-targeted sites were PCR amplified and then NGS-sequenced via Genewiz’s EZ-Amplicon service ...
-
bioRxiv - Neuroscience 2021Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed using Q5® High-Fidelity DNA Polymerase according to the manufacturer’s protocol (Forward primer ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA was extracted using QuickExtract (Lucigen) as previously described (21) ...
-
bioRxiv - Genetics 2020Quote: ... Genomic DNAs were extracted by QuickExtract (Epicentre) solution and amplified by Phusion High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing 30μl QuickExtract DNA Extraction Solution (Lucigen). A full plate containing the reaction mixture (single colony + extraction solution ...
-
bioRxiv - Cell Biology 2019Quote: ... genomic DNA was extracted with QuickExtract (Epicentre) and indels were determined by amplification of the sgRNA target site by polymerase chain reaction using Herculase II Fusion DNA Polymerase (Agilent biotechnologies ...
-
bioRxiv - Immunology 2022Quote: ... and genomic DNA isolated using QuickExtract (Lucigen). The gRNA binding sites were amplified using KOD Hot Start Polymerase (Merck ...
-
bioRxiv - Neuroscience 2023Quote: QuickExtract™ DNA Extraction Solution (QE09050, Lucigen) was used to extract gDNA from the subclones for PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted using QuickExtract (Epicentre) and PCR amplified across sgRNA sites (Table S1) ...
-
bioRxiv - Bioengineering 2023Quote: ... Genomic DNA was extracted using QuickExtract (Lucigen) and the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated using QuickExtract (Epicentre), incubated at 65°C for 6 minutes followed by an incubation at 95°C for 2 minutes using a thermal cycler ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was collected using QuickExtract (Epicentre). Genotyping PCRs were performed with MyTaq HS Red Mix (Bioline) ...
-
bioRxiv - Physiology 2024Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed ATG F (TGGAATCTTCTGAACAGGTGGA ...
-
bioRxiv - Neuroscience 2023Quote: DNA was prepared by either QuickExtract (Lucigen) from iPSCs or Qiagen DNeasy columns (MSNs and U2OS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50 μL DNA QuickExtract solution (Lucigen QE09050) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed using Q5® High-Fidelity DNA Polymerase according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Klenow DNA Polymerase (KP810250, Epicentre, Madison, Wisconsin), and T4 Polynucleotide Kinase (EK0031 ...
-
bioRxiv - Microbiology 2021Quote: Phage DNA extractions were performed from high titer suspensions using the MasterPureTM Complete DNA and RNA Purification Kit (Epicentre), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA of the two parents and the F2 progeny was extracted with the QuickExtract DNA Extraction Solution (Lucigen, QE0905T) according to manufacturer’s protocol with modifications ...
-
Epigenetics of post-operative delirium: A genome-wide DNA methylation study of neurosurgery patientsbioRxiv - Neuroscience 2022Quote: Genomic DNA was extracted from whole blood tissues with the MasterPure DNA extraction kit (MCD85201, Epicentre, Madison, WI, USA) following the recommended protocol ...
-
bioRxiv - Genomics 2022Quote: DNA was isolated from the 16 parental strains using the Masterpure Yeast DNA Purification Kit (Lucigen, Middleton, WI, USA). The Pacific Biosciences protocol “Preparing HiFi SMRTbell® Libraries using SMRTbell Express Template Prep Kit 2.0” was used to create libraries from 30 micrograms of DNA ...
-
bioRxiv - Genomics 2022Quote: High molecular weight DNA was extracted using either the MasterPure Complete DNA and RNA Purification kit (Lucigen; cat. #MC85200), or by standard phenol/chloroform extraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA (gDNA) was isolated using the MasterPureTM Complete DNA and RNA Purification Kit (Epicentre/Lucigen, Middleton, WI, USA) using the DNA purification protocol for bacterial cell samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA (gDNA) was isolated using the MasterPureTM Complete DNA and RNA Purification Kit (Epicentre/Lucigen, Middleton, WI, USA) using the DNA purification protocol for bacterial cell samples ...
-
bioRxiv - Genetics 2022Quote: ... genomic DNA of the single cell clones with good proliferation was extracted using a QuickExtract DNA extraction kit (Epicentre). The exon 23-24 region was amplified by a pair of PCR primer (SMCHD1_PCR ...
-
bioRxiv - Immunology 2022Quote: Genotyping was performed by extracting genomic DNA from fin clips or larvae using the QuickExtract DNA extraction solution (Epicentre) and amplifying loci using EMBL in-house Phusion polymerase ...
-
bioRxiv - Bioengineering 2023Quote: ... The genomic DNA was extracted from homogenized liver tissues using the MasterPure Complete DNA and RNA Purification kit (Lucigen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA extraction from homogenized liver tissue was performed using the MasterPure Complete DNA and RNA Purification Kit (Lucigen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: High molecular weight DNA extraction was performed using the MasterPure™ Complete DNA and RNA Purification Kit from Epicentre. Seven days old-mycelia of P ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from the bacterial pellets using the MasterPure™ Complete DNA and RNA purification kit (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... cells were washed once with 500 µl PBS and genomic DNA was harvested using QuickExtract DNA extraction solution (Epicentre) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... Single colonies of each suppressor strain were obtained and genomic DNA was prepped using MasturePure(tm) Yeast DNA Purification Kit (Lucigen). The DHR1 ...
-
bioRxiv - Genomics 2020Quote: Libraries were prepared from the DNA samples using the NxSeq AmpFREE Low DNA Library kit (Lucigen, Cat no. 14000-2) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA was isolated from candidate RIG-I or IRF3 KO cell clones using the QuickExtract DNA extraction solution (Epicentre). Genomic DNA isolated from the RIG-I or IRF3 KO cell clones was then amplified by PCR using primers spanning exon 1 for RIG-I or exon 2 for IRF3 (see Table 1) ...
-
bioRxiv - Genetics 2019Quote: ... The DNA was prepared and purified by “MasterPure™ Complete DNA and RNA Purification Kit Bulk Reagents” (Epicentre, Wisconsin, USA). The DNA libraries were constructed using the Nextera DNA Flex Library Prep Kit ...
-
bioRxiv - Microbiology 2019Quote: DNA of DBB and MSL71⊤ cells was extracted using the MasterPure™ Gram Positive DNA Purification Kit (Epicentre, WI, USA). The genomes were sequenced using the Illumina HiSeq2000 paired-end sequencing platform (GATC Biotech ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 μl of the whole cell lysate containing the digested chromatin was taken forward into an overnight blunt end ligation reaction (End-It DNA repair kit and Fast-Link DNA ligation kit, Epicentre) with double stranded DNA adapters at 16°C ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells grown on YES solid media were used for genomic DNA preparation using the MasterPure Yeast DNA Purification Kit (Epicentre). The kit manufacturer’s protocol was followed ...
-
bioRxiv - Microbiology 2021Quote: DNA isolation from inactivated cells was carried out using MasterPure™ Gram Positive DNA Purification Kit (Lucigen, Middleton, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was extracted from the frozen tissues (10 mg) with a MasterPure Complete DNA and RNA purification Kit (Lucigen). We used Q5®High-Fidelity 2X Master Mix (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Half of the cells in each well were used to purify genomic DNA via the Epicentre MasterPure DNA Purification Kit (Epicentre). PCR was used to amplify the CRISPR reaction locus with designed primer pairs ...
-
bioRxiv - Developmental Biology 2020Quote: ... Aliquots from these lysates were used for a PCR (with a Taq DNA polymerase with standard Taq buffer NEB or EconoTaq DNA polymerase Lucigen) with respective gene primers and an 18mer M13F-FAM fluorescent tagged primer (5’-TGTAAAACGACGGCCAGT-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... pombe DNA was extracted from cells grown to log phase at 32°C using MasterPureTM Yeast DNA purification kit (Lucigen/Epicentre). Genomic DNA of Ch16-Tel-DSB ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA was isolated from bulk cells transfected with CRISPR/Cas9 plasmids using the epicentre QuickExtract DNA Extraction Solution (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Phage and bacterial genomic DNA were prepared with the MasterPure complete DNA and RNA purification kit (Epicentre, Madison, WI, USA).