Labshake search
Citations for Lucigen :
201 - 250 of 392 citations for 6 Chloro 4 hydroxy 2 methyl 2H thieno 2 3 e 1 2 thiazine 3 carboxylic acid methyl ester 1 1 dioxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 1 U/mL Baseline-Zero DNase (Lucigen), and 0.5 mM PMSF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Ampligase® Reaction Buffer (Lucigen), 10 U Ampligase (Lucigen) ...
-
bioRxiv - Genomics 2022Quote: ... 1 U/μL RNase Inhibitor (NxGen, Lucigen), 1 U/μL reverse transcriptase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 1× RNase R buffer (#RNR07250; Epicentre) in a 10 µl reaction volume at 37 °C for 10 min followed by heat inactivation at 95 °C for 3 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 U/µL Nxgen RNase inhibitor (Lucigen), and 0.1% Tween 20 (blocking buffer ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 7.5 µL Failsafe Premix E (Epicentre), 1.2 µL each of F and R primers (IDT) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G); post-heat shock recovery time was limited to 15-20 minutes to avoid cell division during recovery and ensure that each resulting colony was the result of an independent transformation event ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli cells (Lucigen E. cloni 10G). Around 800 thousand colonies were recovered ...
-
bioRxiv - Biochemistry 2020Quote: ... pNT-15 was constructed using NEB HiFi DNA Assembly with a gBlock® from IDT (Coralville, IA) and cloning vector pSMART-HCKan (Lucigen, #40704-2). All PCR reactions were performed with Q5® Hot-Start High Fidelity Master Mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and a mix of 600 µl of tissue and cell lysis solution and 2 µl Proteinase K from the MasterPure Complete DNA and RNA Purification Kit (Epicentre-Lucigen, Middleton, WI) was added to each sample tube ...
-
bioRxiv - Genomics 2020Quote: Bead arrays with tissue sections were immediately immersed in 200 μL of hybridization buffer (6x SSC with 2 U/μL Lucigen NxGen RNAse inhibitor) for 30 minutes at room temperature to allow for binding of the mRNA to the oligos on the beads ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... ratio overnight at 16 °C followed by purification and then electroporation into phage-display competent TG-1 cells (#60502-1, Lucigen). The library was plated onto 2xYT agar plates containing 100 µg/mL carbenicillin and 2% glucose at 37 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... GU332722.1) or Asia II 1 (GenBank accession no. GU332721.1) was synthesized using the AmpliScribe T7- Flash Transcription Kit (Epicentre, ASF3507), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and aliquots of 100 μL were dispensed into 0.1 mm gapped electroporation cuvettes along with 1 μg of plasmid DNA and 1 μL of Type-One restriction inhibitor (Epicentre). Electroporation was performed with a Bio-Rad Micropulser (Ec3 pulse ...
-
bioRxiv - Microbiology 2020Quote: Samples were analyzed directly or mixed 1:1 with one of the following buffers: Quick Extract DNA Extraction Solution (Lucigen), Virotype Tissue Lysis Reagent (INDICAL BIOSCIENCE GmbH ...
-
bioRxiv - Molecular Biology 2020Quote: ... Comparable results to commercial RNA extraction kits have been obtained using a 5-min direct detection preparation method of nasopharyngeal samples following 1:1 dilution with the Quick Extract DNA extraction Solution (Lucigen) (6) ...
-
bioRxiv - Genomics 2022Quote: ... 4 μl of T5-Tn5 transposome and 4 μl of T7-Tn5 transposome were mixed to form 8 μl of assembled Tn5 transposome before it was mixed with 1 μl cDNA (containing ~500 pg cDNA) and 1 μl reaction buffer (TNP92110, Lucigen). The reaction mixture was incubated at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 u/µl NxGen RNase inhibitor (Lucigen). Control reactions contained 320 µg/ml puromycin (Santa Cruz Biotechnology) ...
-
bioRxiv - Genomics 2020Quote: ... 1 ul Hybridase Thermostable RNase H (Lucigen, H39500) and 1 ul 10 X digestion buffer (500 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... using Endura™ ElectroCompetent Cells (Lucigen 60242-1). Resulting pooled DNA libraries were used to produce lentiviral particles and infect primary cortical neurons.
-
bioRxiv - Plant Biology 2021Quote: ... coli C41 (DE3) cells (Lucigen, Cat# 60442-1) and purified using Ni-NTA agarose (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 u/µl NxGen RNase inhibitor (Lucigen). Control reactions contained 320 µg/ml puromycin (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl of 10× stop solution (TNP92110, Lucigen) was added to the reaction mixture to stop tagmentation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μL/mL Ready-Lyse Lysozyme Solution (Lucigen) and 1 μL/mL benzonase nuclease (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 60 ug total RNA per sample was incubated with 3 uL RNase I (Epicentre #N6901K) for 45 minutes at RT with light shaking ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2019Quote: ... For RNase III tests 1 unit of enzyme (Epicentre) was added 10 min after addition of RNases I and H ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL/mL Ready-Lyse™ Lysozyme Solution (Lucigen) and 1 μL/mL benzonase nuclease (Sigma) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Electroporations were recovered in 1 mL recovery media (Lucigen) for 1 hour and subsequently grown overnight in LB + selection.
-
bioRxiv - Biochemistry 2019Quote: ... and 1 μl of CircLigase I (Epicentre, Madison, WI). Ligation reactions were incubated at 60C for 2 h and the ligase was heat inactivated by incubating at 80C for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 25 μL of Endura electrocompetent bacteria (Lucigen 60242-1) were transformed with 150 ng of library DNA using a 0.1 cm Gene Pulser electroporation cuvette (Bio-Rad 1652083 ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Biochemistry 2022Quote: ... coli cells (E. cloni 10G Elite, Lucigen, USA). Further details on the microfluidic screening can be found in the Supplementary Information.
-
bioRxiv - Cell Biology 2021Quote: ... cloni 5-alpha (short: E. cloni, Lucigen corporation) for all cloning procedures ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... placed into 8-well strips containing 3 μL of cell collection buffer (0.1% Triton X-100, 0.2 U/μL RNAse inhibitor (Lucigen)) ...
-
bioRxiv - Microbiology 2020Quote: ... in combination with 1 µl of RiboGuard RNase Inhibitor (Lucigen) were used instead of the recommended Agencourt RNAclean XP beads to purify samples after enzymatic reactions ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of Fast-Link DNA ligase (Lucigen, cat#LK0750H), and milliQ water up to 15 μl total volume ...
-
bioRxiv - Genetics 2022Quote: ... and 1 uL of CircLigase I (Lucigen CL4111K, Middleton, WI) to the 15 uL of cDNA and incubating at 60 C for 12 hours ...
-
bioRxiv - Microbiology 2022Quote: ... in combination with 1 μl of RiboGuard RNase Inhibitor (Lucigen) were used instead of the recommended Agencourt RNAclean XP beads to purify samples after enzymatic reactions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μL 10 U/μL RecJ Exonuclease (Lucigen/Epicentre, RJ411250). and 1 μL 20 U/μL SUPERase Inhibitor ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μL 10 U/μL RecJ Exonuclease (Lucigen/Epicentre, RJ411250). and 1 μL 20 U/μL SUPERase Inhibitor ...
-
bioRxiv - Immunology 2023Quote: ... Immediately after electroporation 1 ml of prewarmed recovery medium (Lucigen, #800261 was added to the bacteria and the cells were incubated for 1 hour at 37 °C shaking at 250 rpm in a bacterial incubator ...
-
bioRxiv - Microbiology 2023Quote: ... and Escherichia coli BAC-Optimized Replicator v2.0 (Lucigen; 60210–1), Streptomyces mirabilis P8-A218 ...