Labshake search
Citations for Lucigen :
151 - 200 of 200 citations for SARS Coronavirus Membrane Protein Matrix E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... using a Gibson assembly master mix (New England Biolabs).Gibson assembly products were transformed into electrocompetent cells (E. cloni, Lucigen) and plated on 245mm x 245mm square LB-agar plates to obtain the sufficient number of bacterial colonies at a ∼50× library coverage ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli 10G electrocompetent cells (60080-2, Lucigen, Middleton, WI, US). Cells were selected with appropriate antibiotics on solid and liquid culture ...
-
bioRxiv - Genomics 2022Quote: ... Coli cells by electroporation using the manufacturer’s protocol (Lucigen EC300150).
-
bioRxiv - Genomics 2023Quote: ... coli cells by electroporation using the manufacturer’s protocol (Lucigen EC300150).
-
bioRxiv - Microbiology 2023Quote: ... and Escherichia coli BAC-Optimized Replicator v2.0 (Lucigen; 60210–1), Streptomyces mirabilis P8-A218 ...
-
bioRxiv - Biochemistry 2020Quote: ... coli Cloni® 10G cells (Lucigen, USA; 1ul crude reaction mix). Kanamycin selected clones were screened by colony PCR and verified by sequencing ...
-
bioRxiv - Microbiology 2019Quote: Escherichia coli S17-130 and EC100D (Epicentre Technologies, Madison, WI, USA) were cultivated at 37°C in LB).
-
bioRxiv - Microbiology 2020Quote: Escherichia coli TransforMax Epi300 electrocompetent cells (Ref. EC300110, Epicentre, Madison, WI) and Saccharomyces cerevisiae VL6-48N strain [30] were used to propagate the pCC1BAC-His3 containing viral cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... coli cells (Strand et al., 2014; Lucigen, Middleton, WI, Catalog #EC300110) were transformed via heat shock with sequence-verified pPtPBR1 episomes ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmid was maintained in 10G elite Escherichia coli bacteria (Lucigen).
-
bioRxiv - Genetics 2022Quote: ... single BFU-E and CFU-GM were lysed with QuickExtract Lysis Buffer (Epicentre). CFCs were incubated at 65°C for 20 min followed by an incubation at 98°C for 10 min and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... coli strain DH5α was isolated using the QuickExtract DNA extraction solution (Lucigen). The coding sequences of the four autoinducer-2 exporter genes were amplified using the Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 Star (DE3) or OverExpress C43 (DE3) (Lucigen/VWR, Radnor, PA). Following induction with IPTG ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All strains were constructed using Escherichia coli strain C43(DE3) (Lucigen, Madison, WI). The deletion of frdABCD ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli genomic DNA in 15 μL of 1× Ampligase DNA Ligase Buffer (Epicentre) containing 250 ng of unshared E ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli genomic DNA was purified using the MasterPure Gram Positive DNA Purification Kit (Epicentre). All DNAs were purified again using the Zymo Clean and Concentrator-25 (Zymo Research ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli 10G isa highly competent DH10B derivative [54] originally obtained from Lucigen (60107-1). E ...
-
bioRxiv - Immunology 2023Quote: The Escherichia coli strains TG1 and AXE688 (21, 22, 23) were purchased from Lucigen Corporation (Middleton ...
-
bioRxiv - Cancer Biology 2022Quote: ... The library was transformed into electrocompetent Lucigen Endura™ Escherichia coli (Lucigen; cat. 60242-2) using a Bio-Rad MicroPulser Electroporator (#1652100) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli 10G is a highly competent DH10B derivative [39] originally obtained from Lucigen (60107-1). E ...
-
bioRxiv - Microbiology 2021Quote: ... The reconstructed product OmRV-fragment1/pACYC177 was then transformed into 10G chemically competent cells (Lucigen, E. cloni), propagated for plasmid purification with the aforementioned method ...
-
bioRxiv - Synthetic Biology 2020Quote: Golden gate assembly reactions were transformed into chemically competent Escherichia coli prepared from strain TG1 (Lucigen). Transformed cells were selected on Lysogeny Broth containing the antibiotics chloramphenicol ...
-
bioRxiv - Biophysics 2020Quote: The identified sybody genes of positive clones were chemically-transformed into Escherichia coli MC1061 F- (Lucigen) cells ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed nine electroporations of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Genomics 2019Quote: ... coli RNA that underwent reverse transcription and amplification using the ScriptSeq Complete Gold Kit for Epidemiology (Epicentre).
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Microbiology 2022Quote: ... Protein precipitation reagent (Lucigen) was added and samples were spun at maximum speed ...
-
bioRxiv - Genomics 2021Quote: ... We performed 9 electroporations in total of the column-purified plasmid into Endura electrocompetent Escherichia coli cells (Lucigen) using a Gene Pulser Xcell (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... coli chromosome was carried out by electroporating 1 μL of the EZ-Tn5
Tnp Transposome (Epicentre) in 50 μL of EV18-pkD46 electrocompetent cells ... -
bioRxiv - Biochemistry 2021Quote: ... coli DnaB and mutants (R74A, R164A, K180A, R328/329A) were independently expressed in C41 strain (Lucigen, Middelton, WI) from pET11b-derived plasmids as previously described [4] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ligation product was purified by isopropanol precipitation and then transformed into electrocompetent Escherichia coli (Lucigen, Middleton, WI, USA). Transformed cells were plated on to 15 cm Luria-Bertani (LB ...
-
bioRxiv - Immunology 2023Quote: The extracellular domains of HLA-G2 (HLA-G2) were expressed in Escherichia coli ClearColi BL21(DE3) competent cells (Lucigen) to avoid triggering endotoxic responses in human cells ...
-
bioRxiv - Microbiology 2021Quote: ... OmRV-fragment2/pMA (ampicillin resistant) and pACYC177 low-copy-number plasmids were transformed into 10G chemically competent cells (Lucigen, E. cloni), respectively ...
-
bioRxiv - Neuroscience 2021Quote: ProPeL experiments were carried out as previously described8 with the following conditions for in vivo proteome phosphorylation: all CK2 constructs were expressed in Escherichia coli OverExpress C43(DE3) cells (Lucigen) by IPTG induction ...
-
bioRxiv - Biochemistry 2020Quote: ... with Escherichia coli codon usage was synthesized and subcloned into pSol SUMO vector using Expresso® Solubility and Expression Screening System (Lucigen). A pET16b plasmid encoding the fluorescent protein substrate of Mpro (His10-mTurquoise2-TSAVLQSGFRKM-mVenus ...
-
bioRxiv - Biochemistry 2020Quote: ... Mutant proteins were expressed in strain C41 (Lucigen) by induction at mid-log phase (OD600 ∼0.4 ...
-
bioRxiv - Biochemistry 2020Quote: ... Wild-type proteins were expressed in strain C41 (Lucigen) by induction at mid-log phase (OD600∼0.4 ...
-
bioRxiv - Microbiology 2019Quote: ... Protein purification was accomplished using the pETite N-His vector (Lucigen). PCR primers were designed to amplify products for BT2807 and BT2808 containing all amino acids downstream of the predicted signal peptide sequences ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were removed by precipitation with MCP solution (Lucigen, WI, USA) and the supernatant was collected after centrifugation at 17,000 x g for 10 min at 40C ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell lysates were prepared using the EasyLyseTM bacterial protein extract solution (Lucigen Corp. USA) or the CelLytic B reagent (Sigma ...
-
bioRxiv - Plant Biology 2019Quote: ... Fractions containing few endogenous bacterial proteins were pooled and treated with SUMO Express Protease (Lucigen, WI) at 4°C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were chilled on ice for 5 minutes and 175 μl of MPC protein precipitation solution (Lucigen, USA) was added to 300 μl of the lysed sample and vortexed vigorously for 10 seconds ...
-
bioRxiv - Molecular Biology 2019Quote: Proteinase K sensitivity experiments were performed using 1.5ug (protein) of gradient-purified EVs treated with 5 ug /mL Proteinase K (Epicentre) in the absence or presence of 0.05% Triton X-100 at 37°C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Selected clones lacking the expression of protein-of-interest were sequenced to confirm the knockout: cells were resuspended in QuickExtract (Lucigen), incubated at 65 °C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI). Remaining steps followed the recommended PureLink Genomic DNA Mini Kit (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was spun down at 10,000 rcf for 1 min and the supernatant was added to 150 μl of protein precipitation reagent (Epicentre, Lucigen, Middleton, WI). Remaining steps followed the recommended PureLink Genomic DNA Mini Kit (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... eDNA was purified from the samples by removing the proteins and RNA using MasterPure Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), and the DNA concentration was measured using NanoVue Plus (GE Healthcare ...