Labshake search
Citations for Lucigen :
101 - 150 of 796 citations for Cyclic GMP Direct Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... At this stage a small aliquot of cells (75% of the plate) was lysed in 200 μL of QuickExtract DNA Extraction solution (Lucigen) and gDNA was prepared by heating to 65° C for 10 minutes followed by heat inactivation at 95° C for 2 minutes ...
-
bioRxiv - Genetics 2021Quote: ... DNA extraction from 2 x 2 x 2mm fin-tissue clips was performed in a 96-well PCR plate using 100μl of QuickExtract solution (Lucigen, USA) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2022Quote: ... and FACS-sorted into 96-well PCR plates containing 3μl mild lysis buffer (nuclease-free water with 0.2% Triton + 0.1U/μl RNase inhibitor (Lucigen, Cat. 30281-2)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was extracted from 96-well plates of confluent clones using QuickExtract DNA Extraction Solution (Lucigen Corporation, Middleton, WI, USA) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA depletion was performed (rRNA depletion Kit Ribo Zero Magnetic Kit for Gram-positive bacteria; Epicentre [Illumina]) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... Ribo-ZeroTM rRNA Removal Kits (Bacteria) and Ribo-ZeroTM Magnetic Gold Kit (Yeast) (Epicentre, San Diego, CA) were used to remove rRNA from the total RNA ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs) was achieved by incubation of the RNA with the Terminator 5’-Phosphate-Dependent Exonuclease (TEX, Lucigen). For this purpose ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
bioRxiv - Microbiology 2019Quote: ... 10 μg of total RNA of each strain was treated with RNA 5’-Polyphosphatase (Epicentre, Madison, Wisconsin). The dephosphorylated RNAs were self-ligated by T4 RNA ligase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of total RNA were treated by 1MBU of DNAse (BaseLine-Zero™ DNAse, Epicentre, USA) for 20 min at 37°C to remove residual genomic DNA contamination ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Microbiology 2021Quote: ... a combined kit for the ribosomal (rRNA) depletion Ribo-Zero™ Kit (Bacteria) (Epicentre, Illumina, Madison, WI USA) and cDNA library construction kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the plates was used for quick genomic DNA isolation for each of the colonies using QuickExtract DNA extraction solution (Lucigen # QE09050). 5μl of this lysate was used to set up a quick genomic PCR screening for IL-1β knockout clones using checking primers ...
-
bioRxiv - Immunology 2023Quote: ... The cDNA synthesis was performed within each well of a 96-well plate separately using EpiScript™ Reverse Transcriptase (EpiCentre Biotechnologies) using UMI-tagged oligo-dT primer with universal tail (Suppl ...
-
bioRxiv - Genetics 2021Quote: ... ribosomal depleted using Ribo-Zero Kit (Epicentre) and libraries prepared using ScriptSeq v2 RNA-Seq Library Preparation Kit (Epicentre) ...
-
bioRxiv - Systems Biology 2022Quote: ... the ribosomal RNA was depleted by Epicentre Ribo-zero® rRNA Removal Kit (Epicentre). Second ...
-
bioRxiv - Plant Biology 2021Quote: ... A Ribo-Zero magnetic kit (MRZPL116, Epicentre) was used for rRNA depletion from total RNA ...
-
bioRxiv - Immunology 2022Quote: ... ribosomal RNA was removed by Epicentre Ribo-zero™ rRNA Removal Kit (Epicentre) and rRNA-free residue was obtained by ethanol precipitation ...
-
bioRxiv - Microbiology 2022Quote: ATP-Dependent DNase kit (Lucigen, catalog #: E3110K).
-
bioRxiv - Bioengineering 2020Quote: ... using AmpliScribe T7-Flash Transcription Kit (Lucigen) following the manufacturer’s instruction and purified by RNA Clean & Concentrator (Zymo) ...
-
bioRxiv - Genomics 2021Quote: ... and the Globin-Zero Gold kit (Epicentre) to remove globin mRNA and ribosomal RNA ...
-
Multi-omics analysis reveals signatures of selection and loci associated with complex traits in pigsbioRxiv - Genomics 2023Quote: ... Ribosomal RNA was removed by Epicentre Ribo-zeroTM rRNA Removal Kit (Epicentre, USA), and rRNA- free residue was cleaned up by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Poly(A) Polymerase Tailing Kit (Lucigen, UK), Direct RNA Sequencing Kit SQK-RNA002 ...
-
bioRxiv - Genomics 2022Quote: ... oligonucleotide with or without a 5’phosphate or circularized oligonucleotide) were treated with 1 U Terminator exonuclease (Lucigen) or mock treated in the manufacturer’s Buffer A for 1 h at 37 °C followed by 1 h at 30 °C ...
-
bioRxiv - Microbiology 2022Quote: ... two µg of total RNA were treated with 5 U of RNase R (cat. # RNR07250, Lucigen, Middleton, WI) for 40 min at 37 °C ...
-
bioRxiv - Systems Biology 2019Quote: ... Ligation of the 5’ adapter (P5_phospho_adapter, oligo 39) to the cDNA was performed using CircLigase II (Lucigen, CL9021K) for 6 hours at 60°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: Cells plated on glass coverslips were incubated with 5 µg/mL Brefeldin A (BFA) (Epicentre Biotechnologies, Madison, WI) for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 μl of the whole cell lysate containing the digested chromatin was taken forward into an overnight blunt end ligation reaction (End-It DNA repair kit and Fast-Link DNA ligation kit, Epicentre) with double stranded DNA adapters at 16°C ...
-
bioRxiv - Genomics 2020Quote: ... The End-It DNA End-Repair Kit (Epicentre) was used to repair DNA fragments to blunt ends ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosomal RNA was removed by Epicentre Ribo-zero™ rRNA Removal Kit (Epicentre, USA), and the libraries have been generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and NxSeq AmpFREE Low DNA Library Kit (Lucigen) was applied ...
-
bioRxiv - Genetics 2022Quote: ... and the MasterPureTM Yeast RNA Purification Kit (Epicentre). cDNAs were synthesized with the FastQuant RT Kit (with gDNase ...
-
bioRxiv - Cell Biology 2021Quote: ... The End-It DNA End-Repair Kit (Epicentre) was used to repair DNA fragments to blunt ends ...
-
bioRxiv - Microbiology 2020Quote: ... or MasterPure Gram Positive DNA purification kit (Lucigen). Sequencing libraries were prepared using NexteraXT (Illumina) ...
-
bioRxiv - Cell Biology 2019Quote: ... using the ScriptSeq kit (Epicentre, CA, USA SS10906). Libraries were amplified via polymerase chain reaction for 12–15 cycles and sequenced in two lanes on the HiSeq 2000 platform at BGI Genome Center (Shenzhen ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... repaired with End-IT DNA repair kit (Epicentre), A-tailed with Klenow enzyme (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (ii) Shotgun PCR-free library preparation kit (Lucigen) or (iii ...
-
bioRxiv - Plant Biology 2023Quote: ... with NxSeq AmpFREE Low DNA Library Kits (Lucigen). After size selection by AMPureXP beads ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were chilled on ice for 5 minutes and 175 μl of MPC protein precipitation solution (Lucigen, USA) was added to 300 μl of the lysed sample and vortexed vigorously for 10 seconds ...
-
bioRxiv - Molecular Biology 2019Quote: Proteinase K sensitivity experiments were performed using 1.5ug (protein) of gradient-purified EVs treated with 5 ug /mL Proteinase K (Epicentre) in the absence or presence of 0.05% Triton X-100 at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: Ten micrograms of total RNA extracted from cell-samples at OD600 1.2 and 1.8 were treated with 5’-Terminator Dependent Exonuclease (Lucigen, TER51020) as per manufacturer instructions using Buffer A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Circular ssDNA substrate was prepared by circularisation of 5’-32P labelled TK-49 using CircLigase II (Lucigen cat#CL9021K), according to manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 5 min.The successful linearization of ecDNA was verified by verifying its sensitivity to exonucleaseATP-dependent DNase (Lucigen). After treatment with exonuclease ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA from fungal mycelium grown on SDA plates was extracted according to the manufacturer’s instructions (Epicentre, Madison, WI, USA, Cat. No. MC85200). Complete ITS1-5.8S-ITS2 (ITS ...