Labshake search
Citations for Lucigen :
101 - 134 of 134 citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... Ligation of the 5’ adapter (P5_phospho_adapter, oligo 39) to the cDNA was performed using CircLigase II (Lucigen, CL9021K) for 6 hours at 60°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: Cells plated on glass coverslips were incubated with 5 µg/mL Brefeldin A (BFA) (Epicentre Biotechnologies, Madison, WI) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were chilled on ice for 5 minutes and 175 μl of MPC protein precipitation solution (Lucigen, USA) was added to 300 μl of the lysed sample and vortexed vigorously for 10 seconds ...
-
bioRxiv - Molecular Biology 2019Quote: Proteinase K sensitivity experiments were performed using 1.5ug (protein) of gradient-purified EVs treated with 5 ug /mL Proteinase K (Epicentre) in the absence or presence of 0.05% Triton X-100 at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: Ten micrograms of total RNA extracted from cell-samples at OD600 1.2 and 1.8 were treated with 5’-Terminator Dependent Exonuclease (Lucigen, TER51020) as per manufacturer instructions using Buffer A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Circular ssDNA substrate was prepared by circularisation of 5’-32P labelled TK-49 using CircLigase II (Lucigen cat#CL9021K), according to manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 5 min.The successful linearization of ecDNA was verified by verifying its sensitivity to exonucleaseATP-dependent DNase (Lucigen). After treatment with exonuclease ...
-
bioRxiv - Plant Biology 2021Quote: ... both fractions were combined and all subsequent steps performed as previously described (Pfeifer-Sancar et al., 2013) except that the clean-up of RNA 5’-pholyphosphatase (Epicentre)-treated samples was performed by Clean & Concentrator column purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... Metatranscriptomic libraries were prepared for sequencing with the addition of 5–50 ng of RNA to the ScriptSeq cDNA V2 library preparation kit (Epicentre). Metatranscriptomic samples were sequenced with an Illumina NextSeq 500 system using V2 high output 300 cycle reagent kit with PHIX control added ...
-
bioRxiv - Genetics 2019Quote: ... or 2µg (25th and 100th generation samples) of RNA were incubated for 1h at 37°C with 5’ RNA polyphosphatase (Epicentre) at a final concentration of 1U/µl ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs and other uncapped RNA species were depleted from RNA samples using the Terminator™ 5’-Phosphate-Dependent Exonuclease (Lucigen). Following a standard phenol-chloroform-isoamyl precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 µg of total RNA was mixed with 3 µl of diluted ERCC RNA spike-in mix and then digested for 1h at 30°C with 1 unit of Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in 1X Reaction Buffer A containing 10 units of SUPERase-In RNase inhibitor (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: 10ug of Trizol-extracted RNA from mouse cortex and striatum was treated with Terminator 5’-Phosphate dependent exonuclease (Lucigen TER51020) according to manufacturer’s protocol. ...
-
bioRxiv - Microbiology 2023Quote: Tn-5 transposon insertion library was build based on EZ-Tn5™
Tnp transposome system (Lucigen, WI, USA). Competent C ... -
bioRxiv - Molecular Biology 2023Quote: ... 10 μg RNA extracted from the specific tethering assays was incubated in a 20 μl reaction volume with 1 unit of Terminator 5’- phosphate-dependent exonuclease (Epicentre) for 60 min at 30°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... by annealing locus-specific oligonucleotides to a common 5’ universal oligonucleotide and performing in vitro RNA transcription (AmpliScribe T7-Flash Kit, Lucigen, ASF3507)40 ...
-
bioRxiv - Bioengineering 2020Quote: The 5′-biotinylated-E07 (anti-EGFR aptamer) was generated by performing an in vitro transcription reaction (DuraScribe T7 Transcription Kit, Lucigen, #DS010925), as described previously (Ray et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The suspension was spun down at 5,000 x g for 5 minutes and the pellet was resuspended in 100 µl of QuickExtract™ DNA Extraction Solution (Lucigen) and 0.1 µl Ready-Lyse™ Lysozyme solution (Epicentre ...
-
bioRxiv - Developmental Biology 2022Quote: ... These solutions (5.5 µl each) were then used as template for a 20 µl reaction with the AmpliScribeTM T7 Transcription Kit (Lucigen, AS3107). The reaction product was treated with DNAseI and shRNAs were purified using the RNA Clean and ConcentratorTM Kit (Zymo Reasearch ...
-
bioRxiv - Synthetic Biology 2022Quote: Yeast genomic DNA was prepared from 5 mL stationary phase culture either with the MasterPure™ Yeast DNA Purification Kit (Lucigen) according to the manufacturer guidelines or using the Cetyl Trimethyl Ammonium Bromide (CTAB ...
-
bioRxiv - Biochemistry 2022Quote: ... the CleanNGS elute was adjusted to 25ul with 10mM Tris pH 7.5 and the ends of the digested DNA were repaired and phosphorylated at their 5’ end using the End-It DNA End-repair kit (Lucigen #ER0720). DNA was purified using MinElute PCR Purification Kit (QIAGEN #28006) ...
-
bioRxiv - Genetics 2023Quote: ... at least 30 5-FOA resistant clones were grown in YEPD for DNA extraction by MasterPure™ Yeast DNA Purification Kit (Lucigen). The relative location of each chromosome truncation event was determined using multiplex PCR with primers that anneal centromere or telomere proximal to the SiRTA (File S1) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were then prepared from 5 ng of DNA by performing end-repair with the End-it DNA End-Repair Kit (Lucigen, ER81050), followed by A tailing with NEB Klenow Fragment (3’−5’ exo- ...
-
bioRxiv - Biochemistry 2024Quote: ... Fragments sized between 30 and 40 kb were isolated as previously described (Tasse et al., 2010) and cloned into pEPIFOS-5 fosmids (Epicentre Technologies). EPI100 E ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Plant Biology 2020Quote: A BAC library was constructed with pIndigoBAC-5 (Hind III-Cloning Ready) for a heterozygous resistant plant K182 carrying the Rpi-mcq1 followed the instrument (Epicentre, WI, USA). The library is approximately 9× coverage with an average insert size of 85 kb ...
-
bioRxiv - Developmental Biology 2019Quote: ... and was then incubated for 30 min at 37 °C with or without 5 U μg −1 of RNase R (Epicentre Bio-technologies). Reverse transcription was performed using a QuantiTect Reverse Transcription Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... and approximately 80 µg of RNA in 1 mL volume was digested with 5 U of RNase I (Lucigen Cat#E0067-10D1) for 45 min at 25°C ...