Labshake search
Citations for Lucigen :
101 - 150 of 363 citations for 4 3 6 Dimethyl 3 heptyl phenol monoethoxylate ring 13C6 solution since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... genomic DNA was isolated using QuickExtract DNA Extraction Solution (Epicentre). Two sets of PCR primers were designed ...
-
bioRxiv - Developmental Biology 2022Quote: ... Yolk-sac DNA was extracted (QuickExtract DNA Extraction Solution, Epicentre) and used for genotyping to distinguish heterozygous and homozygous Hand2 conditional allele ...
-
bioRxiv - Molecular Biology 2023Quote: ... and genomic DNA was extracted using QuickExtract solution (Lucigen, QE0950).
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... gDNA was obtained by using QuickExtract DNA Extraction Solution (Lucigen), where 10000 cells were resuspended in 100 μl PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cells were lysed using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was harvested using QuickExtract DNA Extraction Solution (Lucigen), and gDNA was prepared by heating to 65°C for 10 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were lysed by QuickExtract™ DNA Extraction Solution (Lucigen) to extract genomic DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Microbiology 2023Quote: ... 50 U/μL Ready-Lyse Lysozyme Solution (Lucigen, WI, USA), 2 U/mL Zymolyase (Zymo Research Corporation ...
-
bioRxiv - Synthetic Biology 2024Quote: DNA was extracted with QuickExtract DNA Extraction Solution (Lucigen#QE09050). For each reaction ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2024Quote: ... 20 µL of QuickExtract DNA Extraction Solution (Epicentre Cat. # QE09050) (prewarmed to 65°C ...
-
bioRxiv - Bioengineering 2024Quote: Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre). Target regions were amplified by PCR with HOT FIREPol® DNA Polymerase (Solis BioDyne ...
-
bioRxiv - Genetics 2023Quote: ... 4 units of Ampligase® DNA Ligase (Epicentre), 0.2 ul of Ampligase® 10X Reaction Buffer ...
-
bioRxiv - Genomics 2023Quote: ... cloni 10G ELITE Electrocompetent Cells (Lucigen 60052-4) in 1mm cuvette (Bio-Rad 1652089 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using QuickExtract genomic DNA extraction solution (Epicentre Biotechnologies) and then screened by PCR amplification of the region of interest ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was isolated with QuickExtract™ DNA Extraction Solution (Lucigen) and targeted sequences were amplified by PCR ...
-
bioRxiv - Physiology 2022Quote: ... sorted (eGFP+) cells was extracted using QuickExtract DNA Extraction Solution (Lucigen). EnGen Mutation Detection Kit (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were removed by precipitation with MCP solution (Lucigen, WI, USA) and the supernatant was collected after centrifugation at 17,000 x g for 10 min at 40C ...
-
bioRxiv - Genomics 2024Quote: ... and gDNA was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) for PCR screening of targeting vector integration ...
-
bioRxiv - Cancer Biology 2024Quote: ... and gDNA was extracted by using QuickExtract DNA Extraction solution (Epicentre) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and genomic DNA were extracted using QuickExtract DNA Extraction Solution (Epicentre). PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... cells were lysed in a Ready-Lyse lysozyme solution (Epicentre Technologies) according to manufacturer’s instructions and lysates were homogenized through QiaShredder columns (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoid DNA was extracted with QuickExtract™ DNA Extraction Solution (Lucigen) and PCR amplified ...
-
bioRxiv - Genetics 2023Quote: ... and extracted genomic DNA with QuickExtract DNA Extraction Solution (QE09050, Lucigen). PCR on the genomic DNA was performed to identify the presence of chromosomes with or without reporter integration56 ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA extraction was done using QuickExtract DNA Extraction Solution (Epicentre, #E09050) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... genomic DNA extracted (QuickExtract™ DNA Extraction Solution, Lucigen, cat. QE09050) and the remainder restimulated with fresh medium and cultured for an additional 14 days (Jones et al. ...
-
bioRxiv - Genetics 2024Quote: ... media aspirated and 30uL of QuickExtract™ DNA Extraction Solution (Lucigen) added to the wells ...
-
bioRxiv - Physiology 2024Quote: ... genomic DNA was isolated with the QuickExtract DNA Extraction Solution (Lucigen). The genomic region targeted with the guide RNA was amplified by PCR (Forward primer sequence ...
-
bioRxiv - Molecular Biology 2024Quote: ... Genomic DNA was extracted with QuickExtract™ DNA Extraction Solution (Lucigen) and the region of interest was amplified by PCR using Phusion High Fidelity DNA Polymerase (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2024Quote: ... and genomic DNA was extracted with QuickExtract DNA Extraction Solution (Lucigen).
-
bioRxiv - Genomics 2024Quote: ... and lysed using 4 µl Ready-lyse lysozyme (Epicentre) for 20 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen, USA). Genomic PCR was performed using 100 ng genomic DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... HSPCs were harvested and QuickExtract DNA extraction solution (Epicentre, Madison, WI, USA) was used to collect gDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... HSPCs were harvested and QuickExtract DNA extraction solution (Epicentre, Madison, WI, USA) was used to collect gDNA ...
-
bioRxiv - Neuroscience 2020Quote: DNA was lysed with 50 μl QuickExtract™ DNA Extraction Solution (Lucigen). Copy numbers were analyzed by quantitative real-time PCR performed in an ABI Prism 7900 HT Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... tail samples were lysed in QuickExtract DNA Extra Solution 2.0 (Lucigen, USA) and PCR reactions were carried out with GoTaq DNA polymerase and with the Primers ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was extracted with QuickExtract™ DNA Extraction Solution (Epicentre, QE09050). Genomic PCR was carried out using Q5® High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: DNA was extracted from cells using the QuickExtract DNA Extraction Solution (Lucigen) and sequencing was performed with 110x coverage using 100 base pair paired end read lengths ...
-
bioRxiv - Biophysics 2021Quote: ... coli strain DH5α was isolated using the QuickExtract DNA extraction solution (Lucigen). The coding sequences of the four autoinducer-2 exporter genes were amplified using the Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... together with 1 1l genomic DNA in QuickExtract DNA Extraction Solution (Lucigen). After droplet generation with the QX200 Droplet generator (Biorad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA for genotyping was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) from harvested yolk sac tissue if available or else from a micro-dissected nick of the extraembryonic anterior proximal region ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was extracted from one plate using QuickExtract DNA extraction solution (Epicentre) to perform genotyping by PCR using primer pairs specifically recognizing the mutated sequences introduced by the ssODN and a genomic sequence adjacent to the region of integration ...
-
bioRxiv - Immunology 2020Quote: ... and resuspended in 50 µL QuickExtract DNA extraction solution (LuciGen, Middleton, WI). The suspensions were transferred to 96-well PCR plates and incubated at 65 °C for 20 min and then at 98 °C for 5 min using a thermocycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen #QE09050) and 1 μl (qsp ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genotyping was performed by using QuickExtract™ DNA Extraction Solution (Lucigen #QE09050) on a fraction of a clone ...
-
bioRxiv - Neuroscience 2024Quote: DNA was extracted from phNPCs with the QuickExtract DNA Extraction Solution (Lucigen). DNA lysate was used as genotyping PCR template with Q5 Hot Start High-Fidelity 2X Master Mix (NEB ...