Labshake search
Citations for Lucigen :
51 - 100 of 118 citations for n4 Benzoyl 5 methyldeoxycytidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Monophosphorylated RNAs were selectively degraded by Terminator 5’-phosphate-dependent exonuclease (Lucigen). Subsequent 5’ dephosphorylation by CIP (NEB ...
-
bioRxiv - Genetics 2021Quote: ... RNA samples for small RNA-seq were treated with 5’polyphosphatase (Lucigen) and prepared using the SMARTer Apollo system with modifications for small RNA library preparation ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the sample was treated with 20 units of 5’ RNA polyphosphatase (Lucigen) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: Monophosphorylated RNAs were selectively degraded by Terminator 5’-phosphate-dependent exonuclease (Lucigen). Subsequent 5’ dephosphorylation by quickCIP (NEB ...
-
bioRxiv - Immunology 2021Quote: ... Monophosphorylated RNAs were selectively degraded by Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen) and RNAs were 5’dephosporylation by quickCIP (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... and 5 electroporations were performed into Endura electrocompetent cells (Lucigen, Middleton WI) and plated onto 24.5 cm2 LB-agar plates ...
-
bioRxiv - Genomics 2021Quote: ... Prior to incubation with Terminator™ 5′-Phosphate-Dependent Exonuclease (TEX) (Lucigen) to remove all residual RNAs containing 5’ monophosphate ...
-
bioRxiv - Microbiology 2023Quote: ... unligated 5’-P RNA fragments were removed using terminator exonuclease (TEX, Lucigen), followed by ligation of transcriptional start site (TSS)-specific adaptors.
-
bioRxiv - Genomics 2023Quote: ... The RNA 5’ ends were dephosphorylated using Heat Labile Alkaline phosphatase (Epicentre), purified using ZYMO columns and treated with RNA 5’ Pyrophosphohydrolase (RppH ...
-
bioRxiv - Genomics 2023Quote: ... The eluted RNA was then treated with 5’ Terminator exonuclease enzyme (Epicentre) to remove the uncapped RNA ...
-
bioRxiv - Biochemistry 2021Quote: 5’ RNA polyphosphatase (Rpp) and T4 Polynucleotide Kinase (PNK) were purchased from Epicentre and NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were sorted in 5 μl of QuickExtract DNA Extraction Kit (Epicentre, USA) in 96-well format.
-
bioRxiv - Molecular Biology 2023Quote: ... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Digestion of cellular RNA preperations with Terminator™5’Phosphate-Dependent Exonuclease (Epicentre) was perforemd to remove the abundant rRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... The purified total mRNA was treated by 5’-Phosphate-Dependent Exonuclease (Lucigen, TER51020) to degrade RNAs with 5’ monophosphates ...
-
bioRxiv - Microbiology 2024Quote: ... and subsequently treated with or without 2 U 5’-phosphate-dependent exonuclease (Epicentre) at 30°C for 1h ...
-
bioRxiv - Molecular Biology 2020Quote: ... The small RNA fraction was treated with 20U of RNA 5’ Polyphosphatase (TAP, Lucigen), in a 50μl reaction at 37°C for 1h ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of circularization reaction mix containing 5 units/µL CircLigase II (Lucigen, CL9021K), 1× CircLigase II buffer (Lucigen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 1.5 μL of 5 U μL-1 Ampligase Thermostable DNA Ligase (Lucigen, USA). Water was added to a total volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... DNAse-treated RNA (5 µg) was mRNA enriched using a Ribo-Zero Magnetic Kit (Epicentre). After Illumina sequencing the reads were mapped to C ...
-
bioRxiv - Microbiology 2020Quote: Synthetic RNA H4 (26) was radiolabeled at its 5’ end using T4 polynucleotide kinase (Epicentre) and [γ-32P]ATP (Perkin Elmer) ...
-
bioRxiv - Microbiology 2023Quote: ... 250 pmol of Qβ-RNA were treated with 60 U of RNA 5’-polyphosphatase (Epicentre) in 1 x polyphosphatase reaction buffer at 37 °C for 70 min ...
-
bioRxiv - Genomics 2024Quote: ... the DNA & rRNA depleted RNA samples were treated with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). After a one-hour incubation ...
-
bioRxiv - Genetics 2023Quote: ... 400 ng of DNA was incubated with 5 U Plasmid-Safe ATP-Dependent DNase (Lucigen), 25 mM ATP solution ...
-
bioRxiv - Genomics 2020Quote: ... 2.5 μL of T4 polynucleotide kinase (5 U/μL) plus 2.5 μL 10X Reaction Buffer (Lucigen) were added to the initial 20-μL nucleic acids solution ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: Synthetic RNA substrate H4 (34) was radiolabeled at its 5’ end using T4 polynucleotide kinase (Epicentre) and [γ-32P]ATP (Perkin Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre, RJ411250), followed by pooling and purification of ligated footprints using an Oligo Clean and Concentrator column (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
bioRxiv - Genomics 2024Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs) was achieved by incubation of the RNA with the Terminator 5’-Phosphate-Dependent Exonuclease (TEX, Lucigen). For this purpose ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of total RNA were treated by 1MBU of DNAse (BaseLine-Zero™ DNAse, Epicentre, USA) for 20 min at 37°C to remove residual genomic DNA contamination ...
-
bioRxiv - Microbiology 2022Quote: ... two µg of total RNA were treated with 5 U of RNase R (cat. # RNR07250, Lucigen, Middleton, WI) for 40 min at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2023Quote: Cells plated on glass coverslips were incubated with 5 µg/mL Brefeldin A (BFA) (Epicentre Biotechnologies, Madison, WI) for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were chilled on ice for 5 minutes and 175 μl of MPC protein precipitation solution (Lucigen, USA) was added to 300 μl of the lysed sample and vortexed vigorously for 10 seconds ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 5 min.The successful linearization of ecDNA was verified by verifying its sensitivity to exonucleaseATP-dependent DNase (Lucigen). After treatment with exonuclease ...
-
bioRxiv - Molecular Biology 2022Quote: ... Circular ssDNA substrate was prepared by circularisation of 5’-32P labelled TK-49 using CircLigase II (Lucigen cat#CL9021K), according to manufacturer recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... both fractions were combined and all subsequent steps performed as previously described (Pfeifer-Sancar et al., 2013) except that the clean-up of RNA 5’-pholyphosphatase (Epicentre)-treated samples was performed by Clean & Concentrator column purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... Metatranscriptomic libraries were prepared for sequencing with the addition of 5–50 ng of RNA to the ScriptSeq cDNA V2 library preparation kit (Epicentre). Metatranscriptomic samples were sequenced with an Illumina NextSeq 500 system using V2 high output 300 cycle reagent kit with PHIX control added ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs and other uncapped RNA species were depleted from RNA samples using the Terminator™ 5’-Phosphate-Dependent Exonuclease (Lucigen). Following a standard phenol-chloroform-isoamyl precipitation ...