Labshake search
Citations for Lucigen :
51 - 100 of 125 citations for PAK4 5 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... 150 ng of each sample was treated with RNA 5’ polyphosphatase (Epicentre) to ensure small RNA capture independently of 5’ phosphorylation status ...
-
bioRxiv - Immunology 2021Quote: ... Monophosphorylated RNAs were selectively degraded by Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen) and RNAs were 5’dephosporylation by quickCIP (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... and 5 electroporations were performed into Endura electrocompetent cells (Lucigen, Middleton WI) and plated onto 24.5 cm2 LB-agar plates ...
-
bioRxiv - Genomics 2021Quote: ... Prior to incubation with Terminator™ 5′-Phosphate-Dependent Exonuclease (TEX) (Lucigen) to remove all residual RNAs containing 5’ monophosphate ...
-
bioRxiv - Microbiology 2023Quote: ... unligated 5’-P RNA fragments were removed using terminator exonuclease (TEX, Lucigen), followed by ligation of transcriptional start site (TSS)-specific adaptors.
-
bioRxiv - Genomics 2023Quote: ... The RNA 5’ ends were dephosphorylated using Heat Labile Alkaline phosphatase (Epicentre), purified using ZYMO columns and treated with RNA 5’ Pyrophosphohydrolase (RppH ...
-
bioRxiv - Genomics 2023Quote: ... The eluted RNA was then treated with 5’ Terminator exonuclease enzyme (Epicentre) to remove the uncapped RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... purified virus RNA was treated with 5 units of tobacco acid pyrophosphatase (Epicentre) to generate 5’ monophosphorylated termini ...
-
bioRxiv - Biochemistry 2021Quote: 5’ RNA polyphosphatase (Rpp) and T4 Polynucleotide Kinase (PNK) were purchased from Epicentre and NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were sorted in 5 μl of QuickExtract DNA Extraction Kit (Epicentre, USA) in 96-well format.
-
bioRxiv - Molecular Biology 2023Quote: ... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Digestion of cellular RNA preperations with Terminator™5’Phosphate-Dependent Exonuclease (Epicentre) was perforemd to remove the abundant rRNA ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified total mRNA was treated by 5’-Phosphate-Dependent Exonuclease (Lucigen, TER51020) to degrade RNAs with 5’ monophosphates ...
-
bioRxiv - Molecular Biology 2020Quote: ... The small RNA fraction was treated with 20U of RNA 5’ Polyphosphatase (TAP, Lucigen), in a 50μl reaction at 37°C for 1h ...
-
bioRxiv - Genomics 2019Quote: ... and ribosomal RNA was depleted by a Terminator-5--Phosphate-Dependent Exonuclease treatment (Epicentre). Ten RNA-Seq libraries were prepared from the enriched RNA samples using the ScriptSeq strand-specific protocol (Epicentre) ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 1.5 μL of 5 U μL-1 Ampligase Thermostable DNA Ligase (Lucigen, USA). Water was added to a total volume of 25 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of circularization reaction mix containing 5 units/µL CircLigase II (Lucigen, CL9021K), 1× CircLigase II buffer (Lucigen ...
-
bioRxiv - Microbiology 2020Quote: ... DNAse-treated RNA (5 µg) was mRNA enriched using a Ribo-Zero Magnetic Kit (Epicentre). After Illumina sequencing the reads were mapped to C ...
-
bioRxiv - Microbiology 2020Quote: Synthetic RNA H4 (26) was radiolabeled at its 5’ end using T4 polynucleotide kinase (Epicentre) and [γ-32P]ATP (Perkin Elmer) ...
-
bioRxiv - Microbiology 2023Quote: ... 250 pmol of Qβ-RNA were treated with 60 U of RNA 5’-polyphosphatase (Epicentre) in 1 x polyphosphatase reaction buffer at 37 °C for 70 min ...
-
bioRxiv - Genetics 2023Quote: ... 400 ng of DNA was incubated with 5 U Plasmid-Safe ATP-Dependent DNase (Lucigen), 25 mM ATP solution ...
-
bioRxiv - Genomics 2024Quote: ... the DNA & rRNA depleted RNA samples were treated with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). After a one-hour incubation ...
-
bioRxiv - Genomics 2020Quote: ... 2.5 μL of T4 polynucleotide kinase (5 U/μL) plus 2.5 μL 10X Reaction Buffer (Lucigen) were added to the initial 20-μL nucleic acids solution ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: Synthetic RNA substrate H4 (34) was radiolabeled at its 5’ end using T4 polynucleotide kinase (Epicentre) and [γ-32P]ATP (Perkin Elmer ...
-
bioRxiv - Plant Biology 2019Quote: ... size-selected DNA fragments (150-350kb) were ligated into HindIII digested vector pIndigoBAC-5 (Epicentre, USA) and transformed into E ...
-
bioRxiv - Molecular Biology 2023Quote: ... and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre, RJ411250), followed by pooling and purification of ligated footprints using an Oligo Clean and Concentrator column (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs) was achieved by incubation of the RNA with the Terminator 5’-Phosphate-Dependent Exonuclease (TEX, Lucigen). For this purpose ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
bioRxiv - Microbiology 2019Quote: ... 10 μg of total RNA of each strain was treated with RNA 5’-Polyphosphatase (Epicentre, Madison, Wisconsin). The dephosphorylated RNAs were self-ligated by T4 RNA ligase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: 5 µg of extracted RNA was depleted from ribosomal RNA using Ribo-Zero Gold Kit (Epicentre Madison). After fragmentation of the rRNA-depleted RNA ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of total RNA were treated by 1MBU of DNAse (BaseLine-Zero™ DNAse, Epicentre, USA) for 20 min at 37°C to remove residual genomic DNA contamination ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Genomics 2022Quote: ... oligonucleotide with or without a 5’phosphate or circularized oligonucleotide) were treated with 1 U Terminator exonuclease (Lucigen) or mock treated in the manufacturer’s Buffer A for 1 h at 37 °C followed by 1 h at 30 °C ...
-
bioRxiv - Microbiology 2022Quote: ... two µg of total RNA were treated with 5 U of RNase R (cat. # RNR07250, Lucigen, Middleton, WI) for 40 min at 37 °C ...
-
bioRxiv - Systems Biology 2019Quote: ... Ligation of the 5’ adapter (P5_phospho_adapter, oligo 39) to the cDNA was performed using CircLigase II (Lucigen, CL9021K) for 6 hours at 60°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: Cells plated on glass coverslips were incubated with 5 µg/mL Brefeldin A (BFA) (Epicentre Biotechnologies, Madison, WI) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were chilled on ice for 5 minutes and 175 μl of MPC protein precipitation solution (Lucigen, USA) was added to 300 μl of the lysed sample and vortexed vigorously for 10 seconds ...
-
bioRxiv - Molecular Biology 2019Quote: Proteinase K sensitivity experiments were performed using 1.5ug (protein) of gradient-purified EVs treated with 5 ug /mL Proteinase K (Epicentre) in the absence or presence of 0.05% Triton X-100 at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: Ten micrograms of total RNA extracted from cell-samples at OD600 1.2 and 1.8 were treated with 5’-Terminator Dependent Exonuclease (Lucigen, TER51020) as per manufacturer instructions using Buffer A ...