Labshake search
Citations for Lucigen :
51 - 100 of 462 citations for 6 OXO 1 2 DIHYDRO 6H PYRROLO 3 2 1 IJ QUINOLINE 5 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Microbiology 2021Quote: ... filled with 1 ml LB supplemented with 25 μg/ml chloramphenicol and 2 µl/ml CopyControl fosmid autoinduction solution (Epicentre Biotechnologies, Cat. No. AIS107F). The plates were grown at 30 °C shaking at 700 RPM for 16 h covered by an AeraSeal gas-permeable sheet (EXCEL Scientific Cat ...
-
bioRxiv - Genomics 2021Quote: ... 11 μL purified CUT&Tag-DNA was used in the reaction (11 μL DNA, 2 μL 10 μM Tn5mC-ReplO1 oligo, 2 μL 10× Ampligase buffer (Lucigen), 2 μL dNTP mix (2.5mM each ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 ul per tube was transformed into two tubes of 50 ml of Endura electrocompetent cells (Lucigen, Cat#60242-2) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2023Quote: ... 2 μl per tube was transformed into two tubes of 50 μl of Endura electrocompetent cells (Lucigen, Cat#60242-2) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The commercial transposome R6Kγori/KAN-2 from Lucigen kit #TSM08KR was used according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... cloni 10G SUPREME Electrocompetent Cells (Lucigen, #60080-2), in 11 parallel transformations (1 mL each ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.1% NxGen RNAse inhibitor (Lucigen; 30281-2)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated with 2 µL of DNase I (Lucigen) at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Immunology 2021Quote: ... and NxGen Rnase Inhibitor (40U/μL; 30281-2 Lucigen). BD Rhapsody cartridges were super-loaded with 60’000 cells each ...
-
bioRxiv - Genetics 2023Quote: ... cloni 10G SUPREME electrocompetent cells (Lucigen Cat#60080-2) using a MicroPulser Electroporator (BioRad) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 1.5 μL of 5 U μL-1 Ampligase Thermostable DNA Ligase (Lucigen, USA). Water was added to a total volume of 25 μL ...
-
bioRxiv - Microbiology 2019Quote: ... NxSeq DNA sample prep kit 2 (Lucigen, Middleton, WI, USA) was used as per manufacturer’s directions with either NEXTFlex 48 barcodes (BioO ...
-
bioRxiv - Microbiology 2019Quote: ... and electroporated with the Ez-Tn5
2> transposome (Epicentre). Cells were recovered for 90 minutes at 30 °C with shaking ... -
bioRxiv - Neuroscience 2021Quote: ... and NxGen RNase Inhibitor (0.2 U/μl; Lucigen, 30281-2). Tissue was then triturated by fire-polished Pasteur pipette (three pipettes of decreasing diameter ...
-
bioRxiv - Microbiology 2021Quote: The EZ-Tn5
2> Tnp transposome (Epicentre Biotechnologies, U.S.A) was introduced into E ... -
bioRxiv - Synthetic Biology 2022Quote: ... coli 10G electrocompetent cells (60080-2, Lucigen, Middleton, WI, US). Cells were selected with appropriate antibiotics on solid and liquid culture ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CAGs-rtTA3 PCRs using EconoTaq PLUS (Lucigen #30033-2). Doxycycline chow (food pellets ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by electroporation into Endura ElectroCompetent Cells (Lucigen, 60242-2) at ∼100x coverage ...
-
bioRxiv - Cell Biology 2023Quote: ... TEV protease 96 or SUMO Express proteinase (Lucigen, 30801-2) was respectively incubated with GST-TEV-tagged G3BP1 proteins and His-SUMO-tagged N proteins at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2021Quote: ... This sequence was cloned into the pSmart (Lucigen Cat#40041-2) shuttle vector using Gibson assembly (New England Biolabs) ...
-
bioRxiv - Genomics 2023Quote: ... Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... Excess linker was degraded by adding 2 μl 10× RecJ buffer (Lucigen), 1 μl RecJ exonuclease (Lucigen) ...
-
bioRxiv - Microbiology 2019Quote: ... subvibrioides ΔdivK mutant using the EZ-Tn5
2> TNP transposome (Epicentre). B ... -
bioRxiv - Genetics 2019Quote: ... 2 ul of Hybridase Thermostable RNase H (Epicenter, Madison, WI: Lucigen H39500) to make 10 ul total and incubated for 30 minutes at 45°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Library (50ng) was electroporated into 25µL Endura electrocompetent cells (60242-2, Lucigen). Cells from eight electroporations were pooled and rescued in 8mL of rescue media for 1hr at 37 ...
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of cells were mixed with EZ-Tn5TM
2> transposome (Lucigen) and incubated on ice for 30 min ... -
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2022Quote: ... oligonucleotide with or without a 5’phosphate or circularized oligonucleotide) were treated with 1 U Terminator exonuclease (Lucigen) or mock treated in the manufacturer’s Buffer A for 1 h at 37 °C followed by 1 h at 30 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was amplified (Epicenter TargetAmp 2-Round aRNA Amplification Kit 2.0, Epicentre Biotechnologies), DNase-treated (RapidOut DNA Removal kit ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 10 μl RNase H buffer and 2 μl hybridase thermostable RNase H (Lucigen) preheated to 45° were added ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in PCR master mix (EconoTaq PLUS 2× Master Mix, Lucigen), the DNA was amplified for 15 cycles and purified (QIAGEN) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The remaining DNA was depleted with 2 U of Baseline-ZERO DNase (Epicentre) and ribosomal RNA was depleted using the Ribo-Zero Plant rRNA removal kit (Epicentre) ...
-
bioRxiv - Genomics 2021Quote: ... 2 uL of library ligation was added to 50 uL Endura cells (Lucigen) then electroporated ...
-
bioRxiv - Molecular Biology 2021Quote: ... Competent cells were electroporated with Ez-Tn5
2> transposome (Lucigen, Madison, WI). Cells recovered for 90 minutes at 30 °C and then played on PYE plates supplemented with kanamycin ... -
bioRxiv - Microbiology 2022Quote: ... and electroporated with the Ez-Tn5
2> transposome (Epicentre, Charlotte, North Carolina). Cells recovered at 30°C shaking for 90 minutes ... -
bioRxiv - Neuroscience 2023Quote: ... transposable element insertional mutagenesis using EZ-Tn5™
2> Insertion Kit (Epicentre) and sequencing were performed ... -
bioRxiv - Microbiology 2019Quote: ... Type 1 restriction inhibitor (1 µl; Epicentre) was added to the plasmid DNA prior to mixing with competent cells ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Bioengineering 2022Quote: 2’-Fluoro ssRNA was produced by IVT using the Durascribe T7 IVT kit (Epicentre). Reactions consisted of 0.2-1 μg of purified DNA template per 20 μl reaction ...
-
bioRxiv - Microbiology 2019Quote: ... Transposome mixtures were prepared by mixing the EZ-Tn5
2> transposon from Epicentre Biotechnologies ... -
bioRxiv - Evolutionary Biology 2021Quote: ... sample 2 was treated with 20 U RNase R (Epicentre/Illumina, Cat. No. RNR07250) for 1 h at 37°C to degrade linear RNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation was performed according to manufacturer’s instructions into Endura ElectroCompetent Cells (Lucigen, 60242-2). Dilution of transformed cells and estimation of the number of colony forming units allowed for calculation of plasmid library coverage of around 200x.
-
bioRxiv - Cell Biology 2023Quote: ... Electroporation was performed according to manufacturer’s instructions into Endura ElectroCompetent Cells (Lucigen, 60242-2). Dilution of transformed cells and estimation of the number of colony forming units allowed for calculation of plasmid library coverage ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... the assembled library plasmid pool was electroporated into Endura cells (Lucigen, Cat #60242-2) at 50-100 ng/µl ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tobacco Acid Pyrophosphatase (Epicentre, discontinued) or recombinant PIR-1 was used to dephosphorylate ppp-RNAs for cloning ppp-RNAs when needed while no such treatment was required for cloning p-RNAs ...