Labshake search
Citations for Lucigen :
551 - 600 of 840 citations for Rat Vacuole Membrane Protein 1 VMP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Microbiology 2019Quote: DNA from late log phase cultures of MAH 11 was extracted using a Masterpure DNA Purification kit (Epicentre), prepared using the TruSeq genome DNA sample preparation kit (llumina ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Cell Biology 2021Quote: RNA extraction for wild type and Sts5-2A cells was performed using MasterPure Yeast RNA Purification Kit (Epicentre) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... The dsDNA library was then converted to modified-base RNA using the Durascribe T7 Transcription Kit (Lucigen, MA170E). This kit produces RNA that is resistant to RNase A degradation through the replacement of canonical CTP and UTP with 2’-fluorine-dCTP (2’-F-dCTP ...
-
bioRxiv - Physiology 2021Quote: ... mRNA was purified from 100 ng of total RNA by using a Ribo-Zero rRNA removal kit (Epicentre) to deplete ribosomal RNA and convert into double-stranded complementary DNA by using an NEBNext mRNA Second Strand Synthesis Module (E6111L) ...
-
bioRxiv - Plant Biology 2021Quote: ... complementary RNA (cRNA) was prepared with the AmpliCap-Max™ T7 High Yield Message Maker Kit (Epicentre Biotechnologies). Oocyte preparation and cRNA injection were performed as previously described [94] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dsRNA was synthesized from the purified DNA using Ampliscribe T7-Flash Transcription kits (Epicentre Technologies, Co., Wisconsin, USA). We designed the PCR primers using the Primer3Web version 4.1.0 (Untergasser et al. ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from 2ml of cells at OD595 = 0.8-1.0 using the Masterpure Yeast RNA Purification Kit (Lucigen). Small RNAs were extracted by resuspending 50ml of pelleted cells at OD595 = 0.8-1.0 in 50 mM Tris–HCl pH 7.5 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... genomic DNA from single colonies was extracted with the MasterPureTM DNA Purification Kit from Epicentre (Cat. No. MCD85201) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA for whole genome sequencing was extracted using the MasterPure™ Yeast DNA Purification kit (Lucigen, US) following the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA fragments for blunt cloning were repaired using an End-It DNA End-Repair Kit (Lucigen, cat#ER0720) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was harvested from snap-frozen pellets (using liquid nitrogen) using the MasterPure Yeast RNA Purification Kit (Epicentre) and stored at −80 °C ...
-
bioRxiv - Molecular Biology 2019Quote: In vitro transcribed (IVT) sequences were produced using the Ampliscribe™ T7-Flash™ Transcription Kit (Lucigen-ASF3507), using 1 ug of purified digestion product as starting material ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and size-selection was performed using the Lucigen NxSeq® AMPFree Low DNA Library Kit (Lucigen, Middleton, WI). Libraries were quantified using a Qubit 2.0 instrument (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA was depleted from the sample using the Gram-negative bacteria Ribo-Zero rRNA Removal Kit (Illumina-Epicentre). RNA-seq libraries were prepared with an Illumina TruSeq stranded RNA kit according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Libraries for WGBS were prepared as follows: DNA fragments were end-repaired using the End-It kit (Epicentre), A-tailed with Klenow exo-(NEB ...
-
bioRxiv - Cancer Biology 2019Quote: We removed rRNA from extracted total RNA using a Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA) and then performed library preparation using a NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Microbiology 2019Quote: DNA from the oral samples were extracted using the MasterPure Gram Positive DNA Purification Kit (Epicentre, Madison, WI). 2 ml TE-buffer containing the sample material was pelleted by centrifugation (10000 rpm for 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 500 ng of total RNA were depleted of ribosomal RNA using the Ribo-Zero rRNA removal kit (Epicentre). The resulting RNA was then used for library preparation using the TruSeq small RNA Sample Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... DNA from the cell pellets were extracted using a MasterPure™ DNA Extraction kit (Epicentre®, Madison, USA) according to the manufacturer’s protocol ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... sgRNA was synthesized in vitro as per the suggested protocol using Ampliscribe T7 Flash Transcription kit (Lucigen, USA). 6xHis-Cas9 protein was synthesized as described previously25 ...
-
bioRxiv - Biochemistry 2021Quote: ... Linear PCR products were ligated by blunt-end ligation using the Fast-link DNA ligation kits from Epicentre. 5μl of the ligation reaction were used for the transformation of chemically-competent E ...
-
bioRxiv - Genetics 2021Quote: ... The purified DNA fragments were then blunted and phosphorylated using End-It DNA End-Repair Kit (#ER0720; Epicentre). Part of the repaired pool was set apart for cloning of singlet libraries ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon mutagenesis was performed with the EZ-Tn5
Tnp Transposome kit (Epicentre, Illumina, CA, USA) and the insertion site of all mutants was determined via arbitrary PCR (Segev et al ... -
bioRxiv - Microbiology 2019Quote: ... All gDNA samples were cleaned to remove the remaining RNA using the Genomic DNA Clean & Concentrator kit (Epicentre) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... total RNA was subjected to rRNA-depletion using RiboZero™ rRNA Removal Kit (EpiCentre Inc., Madison, WI, USA). Double stranded cDNA synthesis was performed with rRNA-depleted mRNA using ScriptSeq™ v2 RNA-Seq Library Preparation guide (EpiCentre Inc. ...
-
bioRxiv - Genetics 2022Quote: We extracted high molecular weight (HMW) genomic DNA using the Masterpure Complete DNA and RNA purification kit (Lucigen), using the protocol for tissue samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of RNA was treated with a beta version of Ribo-Zero Magnetic Gold Kit Yeast (Epicentre) to deplete rRNAs ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.5% SDS) and purified by MasterPure Complete DNA and RNA Purification Kit Bulk Reagents (Epicentre, Madison, WI, USA). RNA was prepared by TRizol according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was extracted from yeast pellets using the MasterPure™ Yeast RNA Purification Kit (Lucigen Cat. No. MPY03100) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the pellet was resuspended in the yeast cell lysis solution from the MasterPure Yeast DNA extraction kit (Epicentre) and DNA was extracted according to the kit procedure.
-
bioRxiv - Microbiology 2023Quote: High molecular weight genomic DNA was extracted using the MasterPureTM Gram Positive DNA Purification Kit (Epicentre, Lucigen, USA). Cells from two plates were re-suspend in 1.5mL 1X PBS and harvested by centrifugation ...
-
bioRxiv - Microbiology 2023Quote: High molecular weight genomic DNA was extracted using the MasterPureTM Gram Positive DNA Purification Kit (Epicentre, Lucigen, USA). Cells from two plates were re-suspend in 1.5mL 1X PBS and harvested by centrifugation ...
-
A scalable, GMP-compatible, autologous organotypic cell therapy for Dystrophic Epidermolysis BullosabioRxiv - Bioengineering 2023Quote: ... and derived keratinocytes from three patients (11 total samples) with the MasterPure Complete DNA Purification Kit (Lucigen #MC85200). The gDNA yield was quantified by the Qubit dsDNA high-sensitivity (HS ...
-
bioRxiv - Molecular Biology 2023Quote: ... mRNA was purified from total RNA after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... a PCR-amplified NLuc gene block was transcribed using AmpliScribe™ T7-Flash Transcription Kit (Lucigen, ASF-3507) following manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... RNA clean-up and library prep were performed using either the Ribo-Zero(TM) rRNA Removal Kit (Epicentre) with the Illumina Truseq Stranded RNA LT kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... and bacterial DNA was extracted using the MasterPure™ Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by addition of 6 mL of recovery medium (Lucigen, F98226-1) and incubation at 37 °C for one hour at 280 rpm rotation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a highly competent derivative of DH10β was obtained from Lucigen (60107-1)53 ...
-
bioRxiv - Neuroscience 2022Quote: ... together with 1 1l genomic DNA in QuickExtract DNA Extraction Solution (Lucigen). After droplet generation with the QX200 Droplet generator (Biorad) ...
-
bioRxiv - Biochemistry 2022Quote: ... The electroporated bacteria were then cultured in recovery medium (Lucigen 80026-1) for 1 hour ...
-
bioRxiv - Genetics 2019Quote: ... 1 μg of RNA was treated with 20 units of RNAseR (Epicentre) in a 25μl reaction at 37°C for 30 minutes ...
-
bioRxiv - Systems Biology 2019Quote: ... and indexed with ScriptSeq™ Index PCR primers set 1 (Epicentre, Illumina) following the standard protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmids were grown in E.Cloni 10G Chemically Competent Cells (Lucigen, 60107-1) and were verified by Sanger sequencing (Eton biosciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 μl of 2.5 U of CircLigase II ssDNA Ligase (Lucigen), and incubating the resultant mixtures at 40°C for 3 h ...
-
bioRxiv - Cell Biology 2023Quote: ... Ruptured cells were treated with 1 U/μl OmniCleave endonuclease (Lucigen, OC7850K) for 5 min at 37°C to release the DNA-bound protein pool ...
-
bioRxiv - Genetics 2023Quote: ... Final assembled products were delivered to Endura Electrocompetent Cells (Lucigen, 60242-1) via electrotransformation (Bio-Rad Gene Pulser II) ...