Labshake search
Citations for Agilent :
151 - 200 of 1341 citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 0.4 μL universal reverse primer (Agilent Technologies), 100 ng cDNA and H2O up to 10 μL was made for each sample ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-K-RasG12V H95C and GFP-H-RasG12V Q95H mutants were designed and ordered from Agilent QuikChange Primer Design (Agilent; Santa Clara, CA). cDNA of H-RasG12V Q95H ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.4 µL universal reverse primer (Agilent Technologies), 100 ng cDNA and H2O up to 10 µL was made for each sample ...
-
bioRxiv - Developmental Biology 2019Quote: ... Mutations in the miR-204 binding sites were generated using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the mutated sequences were confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... Sanger sequencing method was used for confirming TTBK2 mutations and primers were designed using QuikChange Primer Design Program (Agilent) (Table S2) ...
-
bioRxiv - Immunology 2024Quote: ... and explicit RTs was developed by Agilent using 220 individual metabolite standards51’92 93 ...
-
bioRxiv - Immunology 2020Quote: ... Mature miRNA sequence and Universal reverse primer (Agilent) was used as forward and reverse primers respectively ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers introducing mutation sites were designed by Agilent PrimerDesign Program on Agilent website listed in Table 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... TMT sets underwent high pH fractionation on an AssayMap Bravo (Agilent technologies) and fractions run on a nano-LC (Easy1000 Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... set at 60 °C on an HPLC equipment (HPLC 1260 Infinity, Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... and ACT1 were prepared by PCR from CLA1-2 genomic DNA using primers N1 to N10 (Supplementary Table S2d) and radioactively labeled by P32 with Random Primer Labeling Kit (Agilent, 300385). Blots were scanned using Image Quant 5.2 software (Molecular Dynamics).
-
bioRxiv - Pathology 2020Quote: ... Sections were allowed to thaw at RT and thereafter blocked for > 60 min at RT with blocking-buffer (serum-free protein blocking solution, DAKO), supplemented with 0.2% Triton X-100 (Sigma Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR was performed with a StepOnePlus (Agilent) using the Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: RT-qPCR was performed with a StepOnePlus (Agilent) using the Luna Universal qPCR Master Mix (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using primers containing the T7 promoter sequence (on both forward and reverse primers) with PfuUltra II Fusion Hotstart DNA Polymerase (Agilent Technologies, #600672). PCR products with the expected size was separated using 1% agarose gel ...
-
bioRxiv - Neuroscience 2020Quote: ... striatal metabolites were measured with a gas-chromatography/mass-spectrometry set-up (Agilent 7890B GC – Agilent 5977A MSD ...
-
bioRxiv - Biochemistry 2022Quote: ... Mutations were introduced using standard primer-mediated mutagenesis (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... followed by cDNA production using random primers (Agilent Technologies). The ends of the cDNA were repaired ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were reversed transcribed using AffinityScript RT Enzyme (Agilent) to form cDNA ...
-
bioRxiv - Bioengineering 2020Quote: One-step Brilliant II RT-qPCR core kit (Agilent) was used for quantitative analysis of extracted HIV RNA ...
-
bioRxiv - Microbiology 2023Quote: ... The RT-qPCR was run on a Mx3000P (Agilent) using an annealing temperature of 60°C and analyzed against a standard curve of Mitochondrial 18S ribosomal RNA (RRN18S ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Plant Biology 2023Quote: ... Primers were designed according to the Quickchange II manual (Agilent) so that the forward and reverse primers were complementary to each other ...
-
bioRxiv - Immunology 2023Quote: ... site-directed mutagenesis using specific primers was performed (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Mutations were generated within the miR-1 seed sequences using the QuikChange Lightning or QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, California) to disrupt miR-1’s binding and regulatory function (Gregory et al. ...
-
bioRxiv - Microbiology 2021Quote: ... These raw data sets were analyzed separately using the GeneSpring GX12.0 software (Agilent Technologies, USA) followed by differential gene expression and cluster analysis ...
-
bioRxiv - Plant Biology 2021Quote: ... The inlet temperature was set to 260°C and helium flow in the column (Agilent J&W DB-5MS Ultra Inert 30 m ...
-
bioRxiv - Immunology 2021Quote: ... was set up using a plate previously submerged and incubated in XF calibrant (Agilent Technologies) overnight at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... EZH2’s SET domain deletion was generated by a site-directed mutagenesis kit (Agilent, 200521). All plasmids were verified by Sanger sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... 16E6 point mutants were created using QuikChange primer design (Agilent Technologies). NHERF1 truncations were PCR generated and sequenced.
-
bioRxiv - Genomics 2021Quote: ... the sgRNA locus was amplified using primers and Herculase II (Agilent) with 20 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers for mutagenesis were designed using online tools provided by Agilent. WT MEN1 plasmid was used as a template ...
-
bioRxiv - Cell Biology 2021Quote: ... Q-PCR was performed an Mx3000p PCR system (Stratagene) using the Platinium Taq DNA polymerase (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2019Quote: qPCR mixtures were set up using Brilliant III Ultra-Fast qPCR Mastermix (Agilent Technologies, United States), reference dye (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... and single-stranded cDNA was synthesized by AffinityScript RT-RNAse (Stratagene). cDNA synthesized without the RT/RNAse block enzyme mixture was used to control for genomic DNA contamination ...
-
bioRxiv - Microbiology 2021Quote: ... a 10 min incubation at RT with peroxidase blocking buffer (Agilent) and a 30 min incubation at RT with Envision+System HRP Rabbit (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT was performed using a thermociclator Stratagene Mx3005P (Agilent Technologies) with the following steps ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-qPCR reactions were carried out in AriaMX (Agilent, CA, USA). Reactions were set up in 1X PowerUP SYBR Green master mix (Cat No ...
-
bioRxiv - Microbiology 2023Quote: ... a 10 min incubation at RT with peroxidase blocking buffer (Agilent) and a 30 min incubation at RT with Envision+System HRP Rabbit (Agilent) ...
-
bioRxiv - Molecular Biology 2019Quote: ... made using either the Prime-IT RmT Random Primer Labelling Kit (Stratagene) or ...
-
bioRxiv - Immunology 2020Quote: ... Mutagenic oligonucleotides were designed using the QuikChange Primer Design online tool (Agilent) and assessed for the presence of secondary structures using the Oligo Evaluator online tool (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Genomics 2020Quote: An oligonucleotide pool containing the full set of library segments was produced by massively parallel synthesis (Agilent), amplified by PCR ...
-
bioRxiv - Cancer Biology 2021Quote: Target enrichment of genomic DNA was performed using a custom RNA bait set (Agilent SureSelect ELID 3156971), designed complementary to 56 genes implicated in CH and haematological malignancies (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2023Quote: ... and detection window set to 100-1700 m/z with continuous infusion of a reference mass (Agilent ESI TOF Biopolymer Analysis Reference Mix ...
-
bioRxiv - Cell Biology 2021Quote: ... Slides were dried at RT and mounted in Fluorescence Mounting Media (Dako). TUNEL staining was carried out on PFA-fixed sections using the In Situ Cell Death Detection Kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... the ligated product was reverse transcribed using Affinity Script RT enzyme (Agilent) and a primer complementary to the ligated adapter ...
-
bioRxiv - Molecular Biology 2022Quote: ... First strand of cDNA is synthesized using AffinityScript RT Enzyme (Agilent, 600107) according to the manufacturer’s instructions at 54? for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent, P0450) for 1h at RT ...