Labshake search
Citations for Agilent :
1 - 50 of 1343 citations for hsa mir 222 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma Plus PCR Primer Set (Agilent) was used to determine mycoplasma for all cell lines ...
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis was used to introduce mutations into the putative miR-423-5p binding sites on the Cacna2d2 3’UTR using the QuickChange II XL site-direct mutagenesis kit (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR was performed with AccuScript PfuUltra II RT-PCR Kit (600184, Agilent) and a customized RT-primer including unique molecular identifier (UMI ...
-
bioRxiv - Microbiology 2021Quote: ... (labeled regions A and B) were generated using the primer sets and cycle conditions indicated in Table S1B (EasyA PCR kit (Agilent Tech) and BioRad T100 thermal cycler) ...
-
bioRxiv - Microbiology 2020Quote: ... and iii) Mx3000/5P thermocylers series (Agilent)-QuantiFast Probe RT-PCR+ROXvial Kit (Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... A Mx3005p RT-PCR machine (Stratagene) with excitation and emission filters of 492 and 610 nm ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was performed using SybrGreen (Agilent) on the AriaMX (Agilent) ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR reactions were carried out with Stratagene Mx3000P RT-PCR system (Agilent Technologies). Power SYBR™ Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-PCR was performed on a SureCyler 8800 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... Multiple Affinity Removal System (MARS) HSA/IgG spin columns (Agilent) were used to deplete albumins and IgGs from blood samples ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR was performed on AriaMx real-time PCR System (Agilent technologies, USA) with TB Green Premix EX Taq (Takara ...
-
bioRxiv - Microbiology 2021Quote: ... HCV RNA was amplified by RT-PCR using Accuscript (Agilent), and specific HCV oligonucleotide primers that have been previously described [Table S10 of (11)] ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-PCR was performed in AriaMx (Agilent Technologies, software v1.0) using SYBR Green PCR Master Mix (iQ SYBR Green ...
-
bioRxiv - Biochemistry 2023Quote: ... MicroRNAs (miRs) were polyadenylated and then reverse-transcribed using the miR 1st-Strand cDNA Synthesis Kit (Agilent Technologies) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed in an Mx3000P real-time PCR system (Agilent, Santa Clara, CA) using SYBR Premix ExTaq (Takara ...
-
bioRxiv - Molecular Biology 2021Quote: ... Resulting PCR products (“sublibrary mutagenic primers”) were purified using the StrataPrep PCR Purification Kit (Agilent Technologies) and analyzed for quality and concentration using TapeStation electrophoresis with HSD1000 ScreenTapes (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... RNA was first reverse-transcribed with MARSseq barcoded RT primers with the Affinity Script kit (Agilent). Reverse transcription was analyzed by qRT-PCR and samples with a similar CT were pooled ...
-
bioRxiv - Microbiology 2023Quote: ... vRNA and gDNA were both amplified by PCR using R1_forward primer and R1_Reverse primer using Herculase II Fusion DNA Polymerase (Agilent, 600677). PCR products were cleaned up using the QIAquick PCR clean up kit (Qiagen ...
-
bioRxiv - Biochemistry 2020Quote: ... Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent) and analyzed by the MxPro QPCR software (Agilent) ...
-
bioRxiv - Biophysics 2021Quote: Thermofluor assay was performed with a MX3005p RT-PCR instrument (Agilent), SYTO9 (invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative RT-PCR was performed with an Mx3000P qPCR system (Agilent) and analyzed using the MxPro QPCR software (Agilent) ...
-
bioRxiv - Immunology 2024Quote: ... Results were analyzed using the MxPro RT-PCR software (Agilent, USA), and data were expressed as relative mRNA expression = 2−ΔΔCt where ΔCt = Ctunknown – CtHKG and normalized against a house-keeping gene (HKG) ...
-
bioRxiv - Developmental Biology 2023Quote: ... all libraries were ligated to NEBNext® Multiplex Oligos for Illumina® (Dual Index Primer Set I) and quality control was performed using a 2100 Bioanalyser High Sensitivity DNA Kit 5067-4626 (Agilent) and libraries quantified using a QubitTM Fluorometer following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Both the RT-PCR and HRM steps were performed on the ArialMx Real time PCR instrument (Agilent). PCR was performed in 12 μL containing 6 μL Kapa HRM-Fast Master mix (Roche) ...
-
bioRxiv - Neuroscience 2021Quote: ... and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies). qPCR reaction and data were acquired on an Agilent Mx3005P qPCR System.
-
bioRxiv - Immunology 2020Quote: ... Transcripts were quantified using the AccuScript high fidelity RT-PCR system (Agilent) according the manufactures instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Real time RT-PCR was done using Ariamx thermal cycler (Agilent, Germany) with the following parameters ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was amplified using RT-PCR with Brilliant III SYBR Green (Agilent) as per the manufacturer’s instructions using primers ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was amplified using RT-PCR with Brilliant III SYBR Green (Agilent) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a standard curve was constructed via RT-PCR (Agilent, Santa Clara, CA) with copy numbers of the SIV gene ranging from 4.25 x 109 copies to 85 copies using serial dilutions ...
-
bioRxiv - Cell Biology 2023Quote: RT-qPCR was performed using the AriaMx Real-Time PCR System (Agilent) and the SYBR qPCR Master Mix (ref ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized with AffinityScript One-Step RT-PCR Kit (Agilent, 600188). Each cDNA sample was amplified in triplicate using the SYBR Green and Platinum Taq polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The relative transcript accumulation of NaTPS25 was measured using RT-PCR on a Stratagene MX3005P PCR cycler (Stratagene). The elongation factor-1A gene ...
-
bioRxiv - Microbiology 2020Quote: were performed in triplicate in white 96-well PCR plates (4titude) using a RT-PCR machine (MX3005P, Agilent) with excitation and emission filters of 492 and 585nm ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative RT-PCR was performed using the MX3000p Real-Time PCR System (Agilent Technologies, Santa Clara, CA, USA) to determine the mRNA expression levels of SOS1 ...
-
bioRxiv - Microbiology 2020Quote: ... the adapter-ligated/RT primer mixture was used as template with the AffinityScript cDNA Synthesis Kit (Agilent, 600559) with the following reaction conditions ...
-
bioRxiv - Immunology 2022Quote: ... MARS-seq barcoded RT primers were used for reverse transcription with the Affinity Script cDNA Synthesis Kit (Agilent) in a 10 μl reaction volume.
-
bioRxiv - Cancer Biology 2023Quote: ... and RT-qPCR was performed using the 1-Step Brilliant II SYBR Green quantitative RT-PCR master mix kit (Agilent Technologies) on a Bio-Rad C1000 Thermal Cycler CFX96 Real-Time System ...
-
bioRxiv - Cell Biology 2021Quote: ... QuantiTect primer assays and Brilliant III SYBR Green QRT-PCR Kit (Agilent Technologies) in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: Relative steady-state levels of specific RNAs by real-time RT-PCR (qRT-PCR) were analyzed using the Brilliant III Ultra Fast SYBR® Green QRT-PCR Mastermix (Agilent, Waldbronn, Germany). Strand-specific analysis was performed as follows ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time RT-PCR was performed using Mx3005P (Stratagene, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... RT-qPCR was carried out with SYBR Green PCR master mix (Agilent, 600882) on cDNA (diluted 1:5 in water) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative RT-PCR was performed using Brilliant III Ultra-Fast SYBR Green qRT-PCR Master Mix (Agilent Technologies #600886) according to manufacturer’s protocol with 5 ng RNA in 10 µl reactions using 0.5 µM of each primer (Supplementary file 4) ...
-
bioRxiv - Plant Biology 2023Quote: ... The obtained cDNA was used as a template for semiquantitative RT-PCR or Real Time PCR amplification in an AriaMx 1.6 (Agilent). When expression was analyzed using Real Time PCR ...
-
bioRxiv - Genomics 2022Quote: ... RT was performed with a specific primer (5′-CCTACACGACGCTCTTCC-3′) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). RNA degradation was performed by incubating the RT mixture with 10% 1 M NaOH (2μl of RT mixture ...
-
bioRxiv - Microbiology 2023Quote: ... 12µl of sample was incubated with 2µl of 25µM AR2 primer at 72°C for 2min using 10x AffinityScript RT buffer and enzyme (Agilent Technologies), 0.1M DTT ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... 639KKRRRPSALEADSPMAPKR657 were mutated sequentially to alanine with the NLS1a and NLS1b primer sets listed in Table S8 using the QuikChange site-directed mutagenesis system (Agilent, San Diego, CA) to create pET24b(+)-YPet-Kif18B(605-828)-NLS1 ...
-
bioRxiv - Physiology 2020Quote: ... q-RT-PCR was performed using Brilliant III SYBR Green QPCR Master Mix (Agilent) on the StepOne+ Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X Brilliant II qRT-PCR mastermix with 1 uL RT/RNase block (Agilent 600825), and 200 nM forward and reverse primer were used ...