Labshake search
Citations for Agilent :
351 - 400 of 852 citations for Transglutaminase 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... all sections were blocked in a ready-to-use serum free protein blocking solution (Dako/Agilent, Santa Clara, CA) for 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... all sections were blocked in a ready-to-use serum free protein blocking solution (Dako/Agilent, Santa Clara, CA) for 10 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated with 1 × blocking buffer (5% goat serum [#X0907, Dako], 2.5% BSA, 0.1% Triton X-100 in PBS) (38) ...
-
bioRxiv - Pathology 2021Quote: ... The slides were treated with 1× Dako Peroxidase-Blocking Solution® (cat S2023; Agilent Technologies Inc., Santa Clara, CA) for 10 min ...
-
bioRxiv - Immunology 2021Quote: ... all sections were blocked in a ready-to-use serum free protein blocking solution (Dako/Agilent, Santa Clara, CA) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... all sections were blocked in a ready-to-use serum free protein blocking solution (Dako/Agilent, Santa Clara, CA) for 10 minutes at room temperature ...
-
bioRxiv - Pathology 2023Quote: ... Secondary HRP signal was either inactivated by performing two blocking steps of Dako dual endogenous peroxidase block (Dako, S2002) for 10 minutes at room temperature (each) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were then washed thrice in wash buffer (Tris buffered saline with 0.025% Tween) and blocking of endogenous peroxidase was done using peroxidase block (Dako) for 15 minutes ...
-
bioRxiv - Immunology 2024Quote: ... all sections were blocked in a ready-to-use serum free protein blocking solution (Dako/Agilent, Santa Clara, CA) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... all sections were blocked in a ready-to-use serum free protein blocking solution (Dako/Agilent, Santa Clara, CA) for 10 minutes at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Plant Biology 2020Quote: ... Peptides were eluted from the C18 column and into an online Agilent 6550 Q-TOF (Agilent Technologies, USA). A two-hour gradient generating by a 1200 series nano pump (Agilent Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Purified peptide suspensions (2 μL each) were injected into a HPLC-chip (Polaris-HR-Chip-3C18, Agilent Technologies) through a capillary pump with a flow at 1.5 μL/min ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were loaded onto an AdvanceBio Peptide Map column (2.1 × 250 mm, 2.7 μm particle size; part number 651750-902, Agilent), using an Agilent 1290 Infinity II LC System coupled to an Agilent 6495 Triple Quadrupole MS ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were loaded onto an AdvanceBio Peptide Map column (2.1 × 250 mm, 2.7-μm particle size; part number 651750-902, Agilent), using an Agilent 1290 Infinity II LC System coupled to an Agilent 6495 Triple Quadrupole MS as described previously (James et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The peptides from proteins digested were desalted and concentrated with C18 reverse phase chromatography (OMIX C18, Agilent technologies) and peptides were eluted with 80% acetonitrile (ACN ...
-
bioRxiv - Biochemistry 2021Quote: ... Aliquots of the peptide were dissolved in water and purified on a C8 reverse phase HPLC column (Agilent PrepHT Zorbax 300SB-C8 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The peptides were resolved on a reverse phase C18 column (Agilent Poroshell 120 EC-C18 2.7μm, 4.6×50mm) at a flow rate of 350 μl/min and a run time of 10 min ...
-
bioRxiv - Physiology 2019Quote: ... Peptides were introduced to the mass spectrometer from the LC by using a Jet Stream source (Agilent Technologies) operating in positive-ion mode (3,500 V) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Peptides were introduced to the mass spectrometer from the LC by using a Jet Stream source (Agilent Technologies) operating in positive-ion mode (3,500 V) ...
-
bioRxiv - Cancer Biology 2021Quote: Peptide digest was loaded onto a LC system consisting of an Agilent 1200 HPLC (Agilent, Santa Clara, CA) with mobile phases of 5 mM NH4HCO3 ...
-
bioRxiv - Systems Biology 2022Quote: Eluted peptides were desalted using C18 cartridges (5 μL bed volume) on a Bravo AssayMAP Platform (Agilent Technologies). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... Peptide purity was assessed with an analytical column (Agilent, ZORBAX 300SB-C18, 4.6 x 150 mm, 5 μm) at a flow rate of 1 mL/min over a 0-90% B gradient in 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... The digested peptides were loaded onto an AdvanceBio Peptide Map column (2.1 mm × 250 mm, 2.7 μm particle size; part number 651750-902, Agilent), using a Thermo UltiMate 3000 RSLCnano System coupled to an Thermo Altis Triple Quadrupole MS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Extracted peptides were cleaned-up using automated C18 solid phase extraction on the Bravo AssayMAP platform (Agilent Technologies).
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Cancer Biology 2021Quote: Immunohistochemical staining of formalin-fixed, paraffin-embedded xenografts was performed after antigen retrieval (120°C, 7 min at pH9) and peroxidase blocking (Dako) using the UltraVision LP detection system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were de-coverslipped with 1 min of agitation in TBST and subjected to heat-mediated antigen retrieval in 1x pH 6.0 citrate buffer (Biogenex Laboratories, HK0809K) for 20 min at 95°C followed by blocking of endogenous peroxidase activity (Dako, S2003 ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2h at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope.
-
bioRxiv - Cell Biology 2020Quote: The cells were fixed with 4% paraformaldehyde at 4°C for 5 min and permeabilized with 0.1% Triton X-100 at room temperature for 20 min in the presence of a protein-blocking solution consisting of PBS supplemented with 5% normal goat serum (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.2% Triton X-100 and incubation with appropriate secondary antibody for 2 hours at room temperature in blocking buffer before washing and mounting in fluorescent mounting medium (DAKO). Images were acquired using a Leica SP8 confocal microscope.
-
bioRxiv - Cell Biology 2022Quote: ... Non-specific antibody binding was blocked by incubation for 30 min with blocking solution containing 5% normal goat serum (NGS, Dako) at room temperature followed by overnight incubation at 4 °C with different primary antibodies listed in Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the blots were further incubated with a primary anti-total Tau antibody (rabbit Dako-A0024, 1:5000 in blocking buffer), then with the anti-rabbit HRP-conjugated secondary antibody ...
-
bioRxiv - Physiology 2022Quote: ... Membranes were washed with TBS + 0.1% Tween 20 and then incubated for 1h at RT with the following secondary antibodies diluted in blocking buffer: swine anti-rabbit Ig HRP-conjugated (1:3000, catalog no. P0399, Dako) or goat anti-mouse Ig HRP-conjugated (1:5000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Cancer Biology 2021Quote: Biopsy sections were deparaffinized and antigens were retrieved by boiling in 10mM sodium citrate buffer pH6 for 40 minutes followed by endogenous biotin blocking (Agilent) and normal goat serum blocking (Sigma-Aldrich) ...