Labshake search
Citations for Agilent :
101 - 150 of 2160 citations for Toll Like Receptor 3 TLR3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... All antibodies were prepared in antibody diluent from Dako envision kit ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Bioengineering 2021Quote: ... All antibodies were diluted in Dako Antibody Diluent (Dako Antibody Diluent S0809 ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were diluted in Background Reducing Antibody Diluent (Agilent). The tissue was subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Microbiology 2022Quote: ... primary antibodies and appropriate HRP-conjugated secondary antibodies (DAKO). A chemiluminescence substrate (West Dura ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies were diluted in antibody diluent (Agilent; #S3022) and incubated with sections for 16 hours at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... antibodies were diluted in Background Reducing Antibody Diluent (Agilent) and subsequently incubated with an anti-rabbit HRP polymer (Leica ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies diluted in antibody diluent (S080983-2, Dako) were applied on sections for overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... Antibody dilutions were prepared in antibody diluent (Agilent, London, UK). The primary antibodies and concentrations used are as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies were diluted in Dako Real Antibody Diluent (Dako, S2022). Staining was performed on the BenchMark XT immunostainer (Ventana Medical Systems).
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were diluted in Dako antibody diluent (S0809, Dako) and incubated on sections overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were diluted in Dako antibody diluent (S0809, Dako) and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: Anti-iba1 microglial antibody (AlphaLaboratories) or anti-GFAP antibody (Agilent) were used with biotinylated polyclonal goat anti-rabbit immunoglobulin secondary antibodies (Dako ...
-
bioRxiv - Cancer Biology 2024Quote: ... primary antibodies were typically diluted in antibody Diluent (DAKO, S2022) with 2% milk (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Physiology 2019Quote: ... Secondary antibodies (Dako) anti-mouse ...
-
bioRxiv - Biochemistry 2020Quote: ... Antibodies: Ubiqutin (Dakocytomation); Cdc53/yCul1 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2019Quote: ... Secondary antibodies (Dako Donkey anti-goat P0449 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD3 antibody (Dako M725429-2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primary antibodies were probed using species-specific HRPconjugated secondary antibodies (Dako) and viewed using a Chemidoc imager (BioRad).
-
bioRxiv - Cancer Biology 2022Quote: ... All primary antibodies were diluted with Antibody Diluent (Dako, Hamburg, Germany) and incubated for 1 hour at RT ...
-
bioRxiv - Immunology 2022Quote: ... and rabbit anti-LC3B (1:1000) antibodies in Antibody Diluent (Dako) as primary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... The primary antibody was diluted in antibody diluent (S080983-2, Dako) and applied for 60 minutes at room temperature (RT) ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody combined with rabbit anti-mouse-HRP polyclonal antibodies (DAKO). Signals were detected by use of enhanced chemiluminescence (ECL ...
-
bioRxiv - Immunology 2023Quote: ... The primary antibodies used were anti-lysozyme antibody (Abcam, and Dako) and Ki67 (Cell Signaling Technology) ...
-
bioRxiv - Cell Biology 2023Quote: ... prior to incubation with antibodies in Dako antibody diluent (Agilent Technologies) overnight at 4°C in a humidified chamber with the following primary antibodies ...
-
bioRxiv - Cell Biology 2024Quote: Secondary antibodies: Peroxidase-conjugated goat anti-mouse IgG antibody (Dako #P0447) (1:2000) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 x 150-mm Zorbax SB-Aq column (Agilent, Santa Clara, CA). A coupled DAD-3000RS diode array detector (Dionex) ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Cell Biology 2022Quote: ... grown cells were blocked with 1x PBS containing 3% goat serum (DAKO) for 30 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... for cleaved Caspase-3 and HRP labeled polymer and DAB chromagen (Dako) for PCNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001) for PCNA ...
-
bioRxiv - Biochemistry 2023Quote: ... The free HSF2BP protein was analyzed using a BIOSEC 3 column (Agilent) equilibrated in 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA expression was measured using SYBR green on a QuantStudio 3 (Agilent). Probes were generated using NCBI primer blast and are listed in Table X ...
-
bioRxiv - Cell Biology 2020Quote: ... prior to incubation with antibodies in Dako antibody diluent (Agilent technologies S3022). Antibodies and the corresponding dilutions used are listed as follows ...