Labshake search
Citations for Agilent :
251 - 300 of 6350 citations for Testosterone ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and 5 μM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Immunology 2019Quote: A C18 (Agilent ZORBAX 300SB, 5 μm, 300 Å) pre-column (360 μm o.d ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with a Bio SEC-5 2000 Å guard (Agilent). The mobile phase was PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Systems Biology 2022Quote: ... equipped with a VF-5 ms column (Agilent Technologies) of 30 m length ...
-
bioRxiv - Immunology 2023Quote: Images were acquired with a Biotek Cytation 5 (Agilent) and images were analyzed with Biotek Gen5 software ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 μl SYBR green (Agilent Technologies, CA, United States), and 2 μl nuclease-free water ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5’ and mounted with fluorescent mounting medium (Dako). The Lmx1a antibody detection capability was improved using the Tyramide Signal Amplification kit (TSA ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm particle size (Zorbax XDB C8, Agilent Technologies). The analytes were eluted using a gradient starting with 50% mobile phase B that increased to 98% within 2.3 min and was held for 1.0 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse phase-S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Cell Biology 2019Quote: ... The HAP1 cells were seeded in Seahorse XF96 cell culture plate (Agilent) at a density of 30,000 cells per well overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were seeded in a special 16-well plate supplied by Agilent, and cultured in the equipment set inside of a cell culture incubator ...
-
bioRxiv - Immunology 2021Quote: ... The detached cells were re-seeded in XF24 cell plates (Agilent Technologies) at 150,000 MDMs/well or 200,000 BMDMs/well ...
-
bioRxiv - Microbiology 2021Quote: hMDMs (50,000) were plated in XF-96-cell culture plates (Seahorse Bioscience). For OCR measurements ...
-
bioRxiv - Immunology 2022Quote: ... Cells were seeded into Seahorse XFe96-well plates (Seahorse Biosciences, Agilent Technologies) with a density of 1.5 × 105 cells per well and a total volume of 50 μl of cell culture medium to obtain eight replicates per condition ...
-
bioRxiv - Cell Biology 2022Quote: ... Bioluminescence was measured using a Biotek H1 plate reader (BioTek; Agilent Technologies).
-
bioRxiv - Immunology 2022Quote: ... Plates were analyzed using an XFe 24 Extracellular Flux Analyzer (Agilent Technologies). Glycolysis was calculated as average post-glucose ECAR values minus average basal ECAR values.
-
bioRxiv - Neuroscience 2023Quote: ... plates were assayed following manufacturer’s suggested protocols for MitoStress (Agilent #103015-100) and Glycolysis Stress (Agilent #103020-100 ...
-
bioRxiv - Microbiology 2022Quote: ... 384-well plates were prepared using a Bravo liquid handling platform (Agilent) to transfer into each well a 2-μl lysis buffer containing 2 nM reverse transcription (RT ...
-
bioRxiv - Cell Biology 2022Quote: ... sh18.1 or sh18.4 were plated in E-plate 96 well (5232368001; Agilent) at a density of 20,000cells/well ...
-
bioRxiv - Immunology 2023Quote: ... Reactions were made up in Mx3000P 96-well plates (Agilent Technologies, #401333) and data were acquired using a CFX96 Real-Time System C1000 Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plate was incubated and developed with streptavidin-HRP (DAKO P039701-2) and TMB substrate (BD OptEIA ...
-
bioRxiv - Plant Biology 2023Quote: ... 600 nm was recorded daily on a Synergy HT plate reader (Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... The plates were sealed with a peelable aluminium seal (Agilent 24210–001) using a PlateLoc thermal microplate sealer (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... Bioluminescence was read using a BioTek Synergy Neo2 plate reader (Agilent, UK) or a CLARIOstar Plus plate reader (BMG LabTech ...
-
bioRxiv - Cell Biology 2022Quote: ... H2O in the sensor plate was replaced with Seahorse XF Calibrant (Agilent) and cells were washed with HBSS and incubated in Seahorse media (Seahorse XF assay medium (Agilent) ...
-
bioRxiv - Biochemistry 2022Quote: ... Bioluminescence was read using a BioTek Synergy Neo2 plate reader (Agilent, UK) or a CLARIOstar Plus plate reader (BMG LabTech ...
-
bioRxiv - Biochemistry 2022Quote: ... H2O in the sensor plate was replaced with Seahorse XF Calibrant (Agilent) and cells were washed with HBSS and incubated in Seahorse media (Seahorse XF assay medium (Agilent) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The signals were read with a plate reader (Agilent, Santa Clara, CA).
-
bioRxiv - Microbiology 2023Quote: ... plates were washed with 1x PBS using a microplate washer (405LS, Agilent). Cells were then fixed with 4% Formaldehyde and stained with DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plate was read on a microplate reader (Cytation5 spectrophotometer, Biotek, Agilent) upon setting fluorescence at Ex/Em = 485/535 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luminescence values were read on a BioTek Synergy H1 plate reader (Agilent).
-
bioRxiv - Synthetic Biology 2023Quote: ... for incubation in a Cytation 1 multi-mode plate reader (Agilent BioTek). Plate lids were treated with 10% Triton X-100 in ethanol to prevent fogging (73) ...
-
bioRxiv - Microbiology 2023Quote: ... coated Agilent Seahorse XFp cell culture mini plate (Agilent, Santa Clara, CA). The plates were centrifuged at 200g for 1 min with minimum deceleration ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM pyruvate and seeded in a XF plate (Agilent, 103793-100) coated with poly-L-lysine (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...