Labshake search
Citations for Agilent :
51 - 100 of 2945 citations for TNF Receptor II Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Site-directed mutagenesis (QuikChange II, Agilent) was used to introduce the Phe74 to Ala74 codon change in the OsTIR1 coding sequence of pHLP710 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1uL of Herculase II polymerase (Agilent), 1 uL of DMSO ...
-
bioRxiv - Bioengineering 2023Quote: ... the Herculase II polymerase (Agilent Technologies) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... using QuickChange II XL kit (Agilent) and the following primers were used to generate a point mutation on Serine 65 in Parkin (S65E) ...
-
bioRxiv - Developmental Biology 2023Quote: ... using Herculase II polymerase (Agilent, #600675) and was then sequenced to verify the presence/absence of the deletion ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µl Herc II polymerase (Agilent), and 35 µl nuclease-free water were added to the 40 µl gDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the Herculase II polymerase (Agilent, USA) was employed ...
-
bioRxiv - Neuroscience 2022Quote: ... The N100A zDHHC/A17 mutants were generated by our laboratory by site-directed mutagenesis using primers designed by Agilent QuickChange II XL primer design software and using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies), and confirmed by DNA sequencing through Eurofins Genomics (Louisville ...
-
bioRxiv - Bioengineering 2020Quote: ... and RP-HPLC using Thermo Fisher Ultimate 3000 system with AdvanceBio RP-mAb Diphenyl Columns (Agilent Technologies).
-
bioRxiv - Cell Biology 2023Quote: ... metabolic labelling was performed in BOEC protein extracts using ENG mAb SN6h (Dako Denmark A/S, Denmark). Modifying methods of Pece et al,18 a 1 hour “pulse” with 50μCi/ml of 35S methionine ...
-
bioRxiv - Microbiology 2022Quote: ... The MHC-II binding site mutations were introduced into pKK33 by site-directed mutagenesis (QuickChange II, Agilent Technologies) using the primer set SECF44A/L45Afor/ SECF44A/L45Arev ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Herculase II Fusion DNA Polymerase (Agilent). The libraries were sequenced on an llumina NextSeq 500 system with 75 bp read length ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we preformed PCR using PFUultra II (Agilent), the primers F1 and R3 5’gaggtgggcagtcatccatc3’ ...
-
bioRxiv - Genomics 2020Quote: ... the Herculase II Fusion DNA Polymerase (Agilent) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Site directed mutagenesis (Agilent’s QuickChange II kit) was performed using mutagenesis primers detailed in Supplemental Table 1 ...
-
bioRxiv - Genetics 2020Quote: ... Herculase II Fusion DNA Polymerase (Agilent Technologies), 0.25 mM dNTPs (100 mM ...
-
bioRxiv - Genetics 2020Quote: ... Herculase II Fusion DNA Polymerase (Agilent Technologies), 0.25 mM dNTPs (100 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... using PfuUltra II HS DNA Polymerase (Agilent) and primers oADW0274/0275 and cloned into Sma I/CIAP cut pLBG003 to generate plasmid pLBG007 [rips-1prom::RIPS-1::GFP::rips-1 3 UTR] (referred to as RIPS-1::GFP) ...
-
bioRxiv - Neuroscience 2021Quote: ... using QuikChange II XL (Agilent Cat #200521) and primers Irk1-RR-F and Irk1-RR-R ...
-
bioRxiv - Biophysics 2020Quote: ... The QuickChange Lightning II mutagenesis kit (Agilent) was used to create the I57A variant in the CI2_WT_pET22_mCherry vector ...
-
bioRxiv - Physiology 2022Quote: ... An HPLC 1290 Infinity II - (Agilent Technologies) consisting of a 4-channel binary pump ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Herculase II (Agilent) or Q5 High-fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Immunology 2020Quote: ... Quick Change II Site-directed mutagenesis (Agilent) was used to revert mutated sites to the native sequence ...
-
bioRxiv - Genetics 2020Quote: ... 1 µl of Herculase II polymerase (Agilent), 1 µl of DMSO ...
-
bioRxiv - Microbiology 2020Quote: The GeneMorph II random mutagenesis kit (Stratagene) was used to mutagenize the TM2-HAMP-encoding region of phoQ (in pBAD33 phoQ ...
-
bioRxiv - Microbiology 2021Quote: ... or Herculase II fusion DNA polymerase (Agilent) was used for gyrA ...
-
bioRxiv - Molecular Biology 2021Quote: ... PfuUltra II Fusion HotStart DNA Polymerase (Agilent), Accuprime Taq (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... or Agilent Infinite II 1260 (Agilent Technologies) equipped with a refractive index detector and Hi-Plex H ...
-
bioRxiv - Cancer Biology 2022Quote: ... column and HPLC (Agilent 1260 Infinity II). The dried peptides were reconstituted in the mobile phase constituting 30% ACN + 0.1% TFA and loaded on to the column ...
-
bioRxiv - Systems Biology 2022Quote: ... 1 ul of Herculase II polymerase (Agilent), 1 ul of DMSO ...
-
bioRxiv - Physiology 2023Quote: ... and pBluescript II SK+ vector DNA (Stratagene) as stuffer DNA to achieve a final concentration of 120 ng/μl ...
-
bioRxiv - Cancer Biology 2022Quote: ... using Herculase II Fusion DNA Polymerase (Agilent) and 16 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... or Pfu ultra II fusion HS (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using the QuikChange II kit (Agilent Technologies). The pCMP1:chpG:3XHA units were cloned into the E ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2) the pBluescript II SK (-) vector (Agilent) following EcoRV digestion ...
-
bioRxiv - Cancer Biology 2023Quote: ... using Herculase II Fusion DNA Polymerase (Agilent) and 16 cycles ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of Herculase II polymerase (Agilent), 1 μl of DMSO ...
-
bioRxiv - Immunology 2023Quote: ... Site directed mutagenesis (QuikChange II, Agilent, 200523) was performed to introduce a cysteine in position 253 or 107 and 311 to form the covalently bound dimers and a histidine in position 101 to disrupt FLE using the following primers and validated by DNA sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... High-fidelity DNA polymerase PfuUltra II (Stratagene) was performed for site-directed mutagenesis ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the Herculase II Fusion polymerase (Agilent). Illumina P5- and P7-barcoded adaptors were used and PCR amplification and quality controls have been carried out as described by Zhang laboratory (Joung et al ...
-
bioRxiv - Cell Biology 2020Quote: ... pShuttleCMV-Bub1K795R was used to generate recombinant adenoviruses using the AdEasy system (Stratagene), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The mGli2-His recombinant protein was expressed in BL21 (DE3) pLysS cells (Stratagene) and purified under denaturing condition (8 M urea ...
-
bioRxiv - Biophysics 2021Quote: Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies). The produced adenoviruses were purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... Missense mutations in recombinant proteins were generated by QuikChange site-directed mutagenesis (Agilent) using the respective pET28b derivatives as templates ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies) and purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant proteins were expressed in Escherichia coli BL21-CodonPlus (DE3)-RIL cells (Agilent) in LB medium at 16 °C overnight and protein expression was induced by 0.25 mM IPTG (final concentration ...
-
bioRxiv - Immunology 2020Quote: ... FFU/ml) using an anti-NP MAb (HB-65) and a FITC-conjugated anti-mouse secondary Ab (Dako). Geometric mean titers and data representation were performed using GraphPad Prism ...
-
bioRxiv - Biochemistry 2019Quote: ... the gene coding for the kinse domain of the Elk receptor was amplified from TKB1 cells (Agilent Technologies, Santa Clara, CA) and cloned with a C-terminal HA-tag between NdeI and EcoRV restriction sites within the second open reading frame of the pCDF-Duet vector ...
-
bioRxiv - Biochemistry 2023Quote: ... An alanine mutant library of the SNAP-tagged human truncated mGlu5 receptor (mGlu5-Δ856, designated as WT in the following experiments) was generated using Quick-change strategy (Agilent technologies) and verified by sequencing (Eurofins Genomics)11 ...
-
bioRxiv - Molecular Biology 2019Quote: SEC-MALS was performed on a Dawn Heleos II System with an Optilab T-rEX RI detector (Wyatt) and a 1260 Inifinity II LC system (Agilent). The Superose 6 increase 10/300 column (GE Healthcare ...