Labshake search
Citations for Agilent :
451 - 500 of 5538 citations for Swine IL 4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Each RNA sample was processed with fluorescence-labelling to prepare complimentary RNA (cRNA) targets that could be detected by an SBC human ceRNA array V1.0 (4□×□180K, Agilent Technologies). The microarray kit contained 88,371 circRNA probes and 18,853 mRNA probes ...
-
bioRxiv - Microbiology 2021Quote: Headspace CO concentrations were monitored every 2-4 days using an Agilent 6890N gas chromatograph (GC; Agilent Technologies, California, US) equipped with a nickel catalyst methaniser (Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... esters and 4-vinyl guaiacol concentrations were analysed using headspace solid phase micro-extraction coupled with gas chromatography (Agilent 7890A)- mass spectrometry (Agilent 5975C ...
-
bioRxiv - Physiology 2022Quote: ... for 1 h at RT and incubated overnight at 4°C with 1:100 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Developmental Biology 2019Quote: ... for one hour at room temperature and incubated overnight at 4°C with 1:200 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Molecular Biology 2019Quote: ... High mass accuracy was achieved by infusion of 1:4 diluted ESI low concentration tune mix (Agilent Technologies, Waldbronn, Germany) at the start of each chromatographic run ...
-
bioRxiv - Molecular Biology 2019Quote: ... Tissue sections were incubated with 4% bovine serum albumin (BSA) and 8% serum in 1x wash buffer ‘en vision’ (Dako) to eliminate non-specific protein binding sites ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with the primary (Supplementary Table 2) (overnight 4°C) and the secondary (HRP-conjugated anti-mouse or -rabbit, DAKO) (2h ...
-
bioRxiv - Developmental Biology 2021Quote: ... Half of the cDNA was amplified for 17 PCR cycles and a 1:4 dilution of the resulting library was assessed by Agilent Bioanalyzer High Sensitivity DNA kit ...
-
bioRxiv - Immunology 2020Quote: Extracts and 4-OHE1 standard were analyzed using a liquid chromatography system (LC; 1200 series, Agilent Technologies, Santa Clara, CA) that was equipped with a reversed-phase analytical column (length ...
-
bioRxiv - Immunology 2021Quote: ... cells were fixed in 4% PFA and sequentially stained with mAbs to NPM (anti-human/mouse nucleophosmin (NPM) (clone 376, dilution 1:50, Dako) and anti-mouse MPO (Millipore) ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were imaged using a 60x Plan Apo 1.4 NA objective on a Nikon Ti2-E microscope with a Yokogawa X1 spinning disk confocal system, MLC400B 4-line (405nm, 488nm, 561nm, and 647nm) dual-fiber laser combiner (Agilent), Prime 95B back-thinned sCMOS camera (Teledyne Photometrics) ...
-
bioRxiv - Bioengineering 2022Quote: ... and incubated overnight at 4 °C with primary antibodies for the glial fibrillary acidic protein (GFAP; 1:1000, Z0334, Dako), ionised calcium-binding adapter molecule 1 (IBA1 ...
-
bioRxiv - Microbiology 2022Quote: ... One hundred μL of the extract was mixed with 10μL of 4-chlorobenzotrichloride as injection standard and analyzed by GC (HP 7890 Series GC, Agilent, USA) with a 20 m 0.18mm (18μm film thickness ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Cell Biology 2022Quote: ... Plates were immediately centrifuged at 2 000 x g for 20 min at 4 °C and left on ice until insertion into the Seahorse XFe96 Analyzer (Agilent) after the cartridge plate calibration cycle on the analyzer was complete ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Microbiology 2023Quote: Pooled gradient fractions were diluted 1:2 with ice-cold PBS and tumbled overnight at 4°C with 50 µl Strataclean resin (Agilent). Beads were pelleted at 600 RCF for 5 min at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The adapter-modified DNA fragments were enriched by 4 cycles of PCR using SureSelect forward and SureSelect ILM Pre-Capture Indexing reverse (Agilent) primers ...
-
bioRxiv - Biochemistry 2023Quote: ... Shimadzu LC-10AT; autosampler: HiP sampler G1367A, T = 4°C, 10 µL injection; flow rate: 1 mL/min; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept at 4°C overnight with primary antibodies (chicken anti-GFP, Aves Labs, 1:4000; rabbit anti-GFAP, Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were incubated with Alamar Blue for 3-4 hours and then imaged with a Synergy Neo plate reader using excitation: 550 nm and emission: 590 nm (Agilent). The average plate background (media only with 0.1% DMSO ...
-
bioRxiv - Pathology 2023Quote: ... consecutive 4-μm slices of human aspirated thrombi were immunohistochemically stained using antibodies against CD34 (mouse monoclonal, clone QBEnd10; Dako/Agilent), FXI (LSBio) ...
-
bioRxiv - Microbiology 2023Quote: ... Growth curves of OD578 were monitored every hour after 1 min of linear shaking under anaerobic conditions using an Epoch2 microplate reader coupled with a Biostack 4 microplate stacker (both Agilent) housed in a custom-made incubator (EMBL workshop24) ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were labelled with primary antibody for 1 hour at room temperature or overnight at 4°C followed by incubation with HRP-conjugated secondary antibodies (Dako). Membranes were developed using the Western Lightning ECL system (Perkin Elmer) ...
-
bioRxiv - Microbiology 2023Quote: ... This system makes it possible to culture many bacterial strains in parallel in a replicated manner using many 96-well plates which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... Temperature-dependent phase transition was detected by measuring the optical disturbance at 800 nm by increasing the temperature from 4 to 60°C (with a ramping rate of 0.5°C/min) using a spectrophotometer Cary 300UV-VIS (Agilent Technologies). Nitrogen gas purging was used to prevent the moisture from condensing on the cuvette surface.
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibody incubation was performed overnight at 4 °C with rabbit monoclonal anti-PSyn EP1536Y diluted 1:320,000 in DAKO antibody diluent (Agilent #S0809). After three 5-min washes with PBST ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3D z-stacks were taken of each replicate well monitored every 4 hours for 48 hours using a Cytation C10 imager (Agilent) with confocal 546 nm excitation laser ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunohistochemical reaction was developed using 3, 30-diaminobenzidine tetrahydrochloride (DAB) or Purple Kit (Chromo Map DAB or Purple Kit, Ventana, Roche; DAB (Dako) and nuclei were counterstained with Carazzi’s hematoxylin ...
-
bioRxiv - Genomics 2020Quote: ... The resulting PCR product was purified using the NucleoSpin Gel and PCR Clean-up kit (Machery Nagel) and the correct fragment size was confirmed using a High Sensitivity Bioanalyzer DNA Kit (Agilent). For cloning ...
-
bioRxiv - Genomics 2019Quote: ... RNA was quantified using the Qubit RNA broad spectrum kit and purity confirmed using the RNA 6000 pico kit on a bioanalyzer (Agilent).
-
bioRxiv - Genomics 2019Quote: ... WES libraries were prepared using the SeqCap EZ Exome Kit v3 (NimbleGen) or the SureSelect Human All Exon V7 Low Input Exome kit (Agilent). Equimolar pooled libraries were sequenced on HiSeq 2000 and 4000 instruments (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: RNA quantity was determined on the Qubit using the Qubit RNA Assay Kit (Life Tech) and RNA quality was determined on the Bioanalyzer using the RNA Pico Kit (Agilent). Using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... The BAMfile used for IGV visualization was generated from WES data obtained with the SureSelect Human All Exon V6 kit (exome capture kit) from Agilent. Group alignment is by chromosome of mate ...
-
bioRxiv - Biochemistry 2022Quote: ... The preparation of variants was achieved through an error-prone PCR mutagenesis kit (GeneMorph II Random Mutagenesis Kit – Agilent Technologies), following the manufacturer’s instructions in order to insure high proportion of single-mutant variants ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL of each PCR reaction was electrophoresed using the ZAG 130 dsDNA Kit (75-20000 bp) or ZAG 110 dsDNA Kit (35-5000 bp) (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... libraries were quantified with qPCR using the NEBnext Library Quant Kit for Illumina and fragment size assessed with TapeStation D1000 kit (Agilent). Libraries were pooled in equimolar concentration and sequenced using an Illumina NovaSeq 6000 and S2 flow cells (100 cycle kit ...
-
bioRxiv - Cancer Biology 2021Quote: ... hEZH2-K381R-Fv: GGAGCTATGATGCTAGATTCCTTGACTCTAAACTCATACAC and hEZH2-K381R-Rv: GTGTATGAGTTTAGAGTCAAGGAATCTAGCATCATAGCTCC with site-directed mutagenesis kit (QuikChange II Site-directed mutagenesis kit, Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Real-time changes in metabolism were tested using a Seahorse XFe96 Analyzer in conjunction with the Seahorse XF Glycolysis Stress Test Assay Kit and the Seahorse XF Real-time ATP Assay Rate Kit (Agilent). Manufacturer instructions were followed to perform each of the assays ...
-
bioRxiv - Genetics 2019Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first pooled and shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Cell Biology 2020Quote: ... After a cleanup with SPRIselect Reagent Kit and fragment size estimation with High SensitivityTM HS DNA kit runned on 2100 Bioanalyzer (Agilent), the libraries were constructed by performing the following steps ...
-
bioRxiv - Plant Biology 2019Quote: ... a TAG codon was then introduced in the pS2Lb::S2Lb construct by changing one nucleotide using a site-specific mutagenesis kit (QuikChange XL Site-directed mutagenesis kit, Agilent).
-
bioRxiv - Microbiology 2020Quote: ... A series of alanine mutants were introduced into the SARS-CoV-2 spike protein using the QuickChange mutagenesis kit or the QuickChange multi-mutagenesis kit (Agilent). The primers for mutagenesis were designed on Agilent’s website (https://www.agilent.com/store/primerDesignProgram.jsp) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Developmental Biology 2021Quote: ... or deletions in full-length Gpr161 were generated using Quikchange site-directed mutagenesis kit (Stratagene or Q5 Mutagenesis Kit (NEB).