Labshake search
Citations for Agilent :
101 - 150 of 7436 citations for Suppressor of CDC2 With RNA Binding Motif 2 RBMS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg DNase-treated RNA was reverse transcribed using a cDNA Synthesis Kit (Agilent), following the respective manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... and detected by 1:2000 dilution of respective secondary HRP-antibody-conjugates (anti-rabbit, P044801-2, Agilent; anti-mouse, P044701-2, Dako).
-
bioRxiv - Neuroscience 2021Quote: ... TUJ1 (Covance) and CMTM5 (custom made by Pineda, Berlin, Germany Table 2) antibodies were diluted in antibody diluent (DAKO, Hamburg, Germany) and incubated for 48 hours at 4°C in a dark ...
-
bioRxiv - Bioengineering 2023Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... for 60 min and incubated overnight at 4°C with primary antibodies diluted in DAKO Antibody Diluent (Agilent, cat. #S080983-2). Sections were washed in PBS (3 x 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse blood was diluted at 1:200 with antibody diluent solution (DAKO, S080983-2) as the primary antibodies for IHC on wildtype mouse brain paraffin sections ...
-
bioRxiv - Neuroscience 2022Quote: ... the slides were exposed to a mouse-specific biotinylated secondary antibody (GV82111-2, Dako) for 15 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were stained with HAstV mouse monoclonal antibody 8E7 (2 μg/ml DakoCytomation) for 1 hour at room temperature followed by anti-mouse IgG labeled with Alexa Fluor 488 (anti-mouse IgG-Alexa Fluor 488 ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by HRP-conjugated anti-mouse secondary antibody polymer (EnVision+; Dako-Cat# K400311-2) and visualized by Cy7-tyramide as substrate ...
-
bioRxiv - Genomics 2019Quote: ... were washed three times with 200 μl binding buffer (SureSelect Target Enrichment, Agilent Technologies), before incubation with the Hi-C DNA/RNA capture bait mixture with 200 μl binding buffer for 30 min at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... Non-specific protein binding was blocked by incubation with 10% normal goat serum (DAKO). Primary antibodies were applied overnight at 4 ...
-
bioRxiv - Biochemistry 2020Quote: ... The non-specific binding was blocked for 30 min with 5% rabbit serum (DakoCytomation) for the primary mouse serum(1:600) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutation of the CTCF binding site was obtained by QuickChange Site-directed Mutagenesis (Stratagene) using a pair of mutagenic oligonucleotides (Table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... and Iba-1 (ionized calcium binding adaptor protein, 1:5000, Dako, Cat#019-19741). Mouse anti-SARS-CoV-2 N monoclonal antibody (1:5000 ...
-
bioRxiv - Immunology 2022Quote: ... IgG binding was detected by incubation with Cy3-rabbit anti-human IgG (Dako Cytomation) labeled according to the manufacturer’s recommended protocols (GE Healthcare) ...
-
bioRxiv - Immunology 2021Quote: ... Non-specific protein binding was blocked by incubation with 10% normal goat serum (DAKO). The nonspecific binding of antibodies was blocked using 10% normal goat serum (DAKO ...
-
bioRxiv - Microbiology 2021Quote: ... Disruption of the G4 motif in both genes was performed by site-directed mutagenesis using Pfu Turbo (Agilent) and DpnI (ThermoFisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated for 30 minutes at room temperature with the secondary antibody (Supplementary Table 2)(1:500 diluted in DAKO Antibody Diluent). Cells were washed with 0.2% Triton X-100 in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... three washes with phosphate buffered saline (PBS) and the incubation with the primary antibody in the DAKO Real TM antibody diluent (Agilent #S202230-2) for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... HRP-conjugated polyclonal antibody (goat anti-rabbit) is purchased from DakoCytomation (Glostrup, Denmark; D048701-2). Mouse LH reference prep (AFP5306A ...
-
bioRxiv - Neuroscience 2023Quote: ... HRP-conjugated polyclonal antibody (goat anti-rabbit) was purchased from DakoCytomation (Glostrup, Denmark; D048701-2). Mouse LH reference prep (AFP5306A ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Cell Biology 2020Quote: We constructed the MELT motif mutants of Spc105 using the QuickChange II XL Site-Directed mutagenesis kit (Agilent Technologies). To build pAJ737 (Spc105_#4-6 in #1-3) ...
-
bioRxiv - Cell Biology 2020Quote: The doxycycline-inducible Tiam1-AA (non-βTRCP-binding) mutant was generated by Quikchange II (Agilent) site-directed mutagenesis of WT-Tiam1 mouse cDNA at S329 and S334 ...
-
bioRxiv - Cancer Biology 2021Quote: Ligand binding to protein was detected using DSF on an MX3005P qPCR system from Agilent Technologies as described elsewhere.37 Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... where non-specific binding cites were blocked with 4% normal rabbit serum (X0902; Dako, DK), the primary antibody was a polyclonal goat anti-IBA1 (ab5076 ...
-
bioRxiv - Immunology 2023Quote: ... Mutations of OVOL1 binding sites were performed using QuikChange Lightning site-directed mutagenesis kits (Agilent).
-
bioRxiv - Cell Biology 2019Quote: ... and then probed with primary antibody (see Supp. Table 2) followed by the appropriate HRP-conjugated secondary antibody (1:5000) (Agilent, Santa Clara, CA).
-
bioRxiv - Cancer Biology 2021Quote: ... before low pH antigen retrieval and staining with CD8a and Ki67 (Supplementary Table 7) antibodies and secondary antibody (EnVision+ HRP-rabbit, Dako, catalog #K400311-2) using the EnVision DuoFlex system (Dako) ...
-
bioRxiv - Biochemistry 2021Quote: ... and 12 were used as primary detection against T22 capture antibody) was an anti-tau polyclonal rabbit antibody (A002401-2) purchased from Agilent (Santa Clara, CA). A goat anti-rabbit IgG (H+L ...
-
bioRxiv - Systems Biology 2019Quote: ... and purified DENV-2 RNA genome (Supplementary Figure S4) was assessed using an Agilent Bioanalyzer (Agilent Technologies) with RNA 6000 Nano or Pico chips.
-
bioRxiv - Cancer Biology 2023Quote: ... All libraries were sequenced (2×100 bp) using Agilent SureSelect RNA XTHS2 All Exon V8 (Agilent, G9991A)according to the standard agilent protocol.
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated for 2 hours in biotinylated swine anti-rabbit secondary antibody (1:200, Dako) followed by 2-hour incubation in Vectastain ABC (avidin-biotin ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Cell Biology 2022Quote: ... Antibodies against EGFR (2-18C9) and Ki-67 (M1B1) were obtained from Agilent (Santa Clara, CA). The anti-MCT1 antibody was obtained from Merck (Rockville ...
-
bioRxiv - Neuroscience 2023Quote: ... the labelled antibodies were developed with a Dako Liquid DAB+ substrate chromogen system (Dako; GV82511-2).
-
bioRxiv - Systems Biology 2020Quote: Block 3-6s for the motif-rich core regions of our synthetic promoter constructs were amplified from a library synthesized by Agilent Technologies (LeProust et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutations of the two Walker-A motifs in human ABCF1 (K324M, K664M) were created by using Quikchange II Site Directed Mutagenesis Kit (Agilent). Human ABCF1 and yeast GCN20 domain fusion cDNAs were created by PCR-mediated ligation and cloned into modified pMtac-His6 vector ...
-
bioRxiv - Biochemistry 2019Quote: ... the relevant tetrapeptide motifs were inserted into iBox-PAK4cat within the pXJ40 vector [1] using the Quikchange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... A targeted mutation in the Nudix motif was introduced through use of the QuikChange site-directed mutagenesis kit (Agilent Technologies) to produce a plasmid encoding L375 (E258Q).
-
bioRxiv - Microbiology 2021Quote: ... Site-directed mutations in the putative Nla28 binding site were generated using the Quickchange system (Agilent) as previously described (5 ...
-
bioRxiv - Developmental Biology 2020Quote: ... p10UAST-Robo1-MYC and the p5UAST-HA-Robo1 constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Robo coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... or of the phospho FFAT motif (Y768A, T770A, T770D/P771A) were generated using site-directed mutagenesis (QuikChange II XL; Agilent technologies) of EGFP-Miro1 ...
-
bioRxiv - Neuroscience 2022Quote: ... the following primers were used to mutate the WIRS motif in the pcDNA3-DCCWT-HA construct using the Quikchange II site-directed mutagenesis kit (Agilent, #200523): CAACTCACCCACTCCGCGCCGCTGCTAATCCTTTGCTACC and GGTAGCAAAGGATTAGCAGCGGCGCGGAGTGGGTGAGTTG ...
-
bioRxiv - Neuroscience 2022Quote: ... and the p5xUAST-Fra-Myc constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Fra coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... TP53-missense mutations and protospacer adjacent motif (PAM) sequence mutation were introduced using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies). A puromycin or neomycin resistance cassette was cloned into the BamHI site which was placed between left- and right-arm of the amplified and cloned DNA fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mutagenesis of the HDE-like motifs and PAM sequence within donor plasmid for HDR was performed using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). pcDNA3.1(+)-ARRDC4-1 and pcDNA3.1(+)-ADCYAP1-2 expression vectors were constructed by cloning lnc-ARRDC4-1 and lnc-ADCYAP1-2 sequences to pcDNA3.1(+ ...
-
bioRxiv - Molecular Biology 2023Quote: ... The desired PNUTS mutant in the RVXF motif (converting the RISW motif to RASA) was generated by oligonucleotide-mediated site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent Technologies) following the manufacturer’s instructions ...