Labshake search
Citations for Agilent :
1 - 50 of 206 citations for Sodium 40 wt. % dispersion in oil since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: WT AD293 cells (WT) (Agilent Technologies, Inc.) and AD293 cells deleted of WDR62 by CRISPR/Cas9-sgRNA (WDR62 KO ...
-
bioRxiv - Plant Biology 2020Quote: ... pAD-WT and pBD-WT from the HybriZAP 2.1 kit (Stratagene, USA) were used as a control of positive interaction (C+) ...
-
bioRxiv - Plant Biology 2024Quote: ... pAD-WT and pBD-WT from the HybriZAP 2.1 kit (Stratagene, USA) were used as controls of positive interaction in all Y2H assays.
-
bioRxiv - Cancer Biology 2021Quote: Biopsy sections were deparaffinized and antigens were retrieved by boiling in 10mM sodium citrate buffer pH6 for 40 minutes followed by endogenous biotin blocking (Agilent) and normal goat serum blocking (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... mouse-anti-human EGFR (Dako, DAK-H1-WT), and CLTX-biotin ...
-
bioRxiv - Immunology 2022Quote: ... 1mM sodium pyruvate (Agilent), for primary B cells 10mM glucose (Agilent) ...
-
bioRxiv - Biochemistry 2024Quote: ... which was restored to WT tyrosine using QuikChange (Agilent) mutagenesis.
-
bioRxiv - Immunology 2023Quote: WT BMMs were seeded the Seahorse Bioscience XF24 (Agilent) cell culture plates and treated with oxLDL (10 µg/mL) ...
-
bioRxiv - Genomics 2023Quote: ... into WT KCNQ1 cDNA (NM_000218.3) using QuikChange mutagenesis (Agilent). The KCNQ1 gain-of-function variant (p.S140G ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM sodium pyruvate (Agilent) and 2 mM L-glutamine (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM sodium pyruvate (Agilent), and 2 mM glutamine (Agilent)) ...
-
bioRxiv - Cell Biology 2021Quote: ... pCMV6-XL5-WT-SorLA759 or pCMV6-XL5-WT-SorLA2131 plasmids using the QuikChange II XL Site-Directed Mutagenesis Kit from Agilent (Santa Clara, CA, USA) according to manufactory’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... α-Lysosyme (1:40, Dako, A0099), α-Ki-67 (1:250 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: ... sodium citrate pH 6.1 (Agilent Dako) for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... sodium citrate pH 6.1 (Agilent Dako) for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... 1 mM of sodium pyruvate (Agilent), and 2 mM of L-glutamine were used ...
-
bioRxiv - Immunology 2024Quote: ... 1mM sodium pyruvate (Agilent, 103578-100), and 2mM glutamine ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1% (v/v) NP-40] was incubated with 40 μg of rabbit anti-mouse antibody (DakoCytomation) in a vertical wheel for 90 min at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCRs were performed on WT genomic DNA with PfuUltra II (Agilent). The 50 μl PCR mix contained 6-10 μl dNTP mix (2.5 mM each) ...
-
bioRxiv - Immunology 2024Quote: ... 1 mM sodium pyruvate (Agilent, 103578-100), and 10 mM D-glucose (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... in sodium citrate (pH 6, DAKO, #S1699). Endogenous peroxidase activity was quenched in 0.3% hydrogen peroxide in PBS ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... and 40 nM streptavidin-conjugated APC (Prozyme) in Lance detection buffer (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2021Quote: WT or mutant nsp1 was expressed using BL21-CodonPlus (DE3)-RIPL cells (Agilent) using Overnight ExpressTM instant TB medium (Novagen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 µl of protein sample in assay buffer (20 mM sodium phosphate, 20 mM sodium chloride, pH 8) was injected onto a C4 column (Agilent) and eluted in a water (1% FA ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 mM sodium pyruvate (103578; Agilent Technologies) for 1 hour prior to assay.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 1 mM sodium pyruvate (Agilent Bioscience), 2 mM glutamine (Wisent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... template WT plasmid was digested by the addition of 1 μL DpnI (Agilent Technologies) for 5 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2020Quote: Mutagenesis was performed on the pET21b(+)-TrpR-Wt plasmid using the QuikChange technique (Stratagene) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2022Quote: ... and 1 mM sodium pyruvate (103578-100, Agilent Technologies). To investigate mitochondrial respiration and energetic phenotypes a Seahorse XFp Cell Mito Stress Test kit (103010-100 ...
-
bioRxiv - Bioengineering 2022Quote: ... L-glutamine and sodium pyruvate (Agilent tech #103334-100). The cells were incubated at 37 °C for 1 hr prior to starting the assay ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 mM sodium pyruvate (103578-100, Agilent Technologies). To investigate mitochondrial respiration and energetic phenotypes a Seahorse XFp Cell Mito Stress Test kit (103010-100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 1 mM sodium pyruvate (Agilent 103578-100), 2 mM glutamine (Agilent 103579-100) ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 1mM sodium pyruvate (Agilent Technologies, 103578-100), 10mM glucose (Agilent Technologies ...
-
bioRxiv - Genetics 2020Quote: ... Variants were then introduced into the WT sequence using QuikChange Lightning Site-Directed Mutagenesis (Agilent) according to the manufacturer’s protocols via overlapping primers containing the alteration ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pEGFP-Dynamin 2.WT was constructed using a Quik Change II XL (Agilent) site-directed mutagenesis kit to change the GCC (alanine ...
-
bioRxiv - Neuroscience 2023Quote: ... or Aβ (Dako, code: M087201-2; 1:40 dilution), together with hematoxylin ...
-
bioRxiv - Immunology 2020Quote: ... 2 mM sodium pyruvate and 25 mM glucose (all Agilent) for 1 h in a non-CO2 incubator at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Support fibers were generated from 5 wt% solutions of polystyrene (MW: 15,000,000 g/mol, Agilent Technologies) dissolved in xylene ...
-
bioRxiv - Biophysics 2023Quote: ... The WT and high-specificity Rec3 plasmids were transformed into BL21-Gold (DE3) competent cells (Agilent) and expressed in lysogeny broth (LB ...
-
bioRxiv - Cell Biology 2023Quote: ... The P878A mutation was generated from the WT plasmid using the Quikchange Lightning mutagenesis kit (Agilent) and primers (CCTAGGCCTCCACCAGCAGAGGAAAAGGATG ...
-
bioRxiv - Biophysics 2023Quote: ... Mutations in WT hERG1a cDNA were made using the QuikChange site-directed mutagenesis kit (Agilent Technologies) and verified by DNA sequence analysis ...
-
bioRxiv - Pathology 2024Quote: ... and podoplanin (mouse monoclonal antibody, clone D2-40; Dako/Agilent). Detailed information on these primary antibodies is presented in Table S2 ...
-
bioRxiv - Pathology 2024Quote: ... and podoplanin (mouse monoclonal antibody, clone D2-40; Dako/Agilent). Detailed information on these primary antibodies is presented in Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were conducted using a RoboCycler Gradient 40 (Stratagene). Reaction solutions were incubated at 94°C for 5 minutes before undergoing 35-40 rounds of amplification cycles ...
-
bioRxiv - Immunology 2024Quote: ... for 40 min and imaged using a Cytation5 (Agilent BioTek) every 7–8 h over a duration of 2 d.
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... supplemented with 1 mM sodium pyruvate (Agilent Technologies, Cat#: 103578-100), 10 mM glucose (Agilent Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... a point mutation was introduced into the WT plasmid using the QuikChange site-directed mutagenesis method (Agilent). HEK-293 cells were transiently transfected with NaChBac WT or T220A cDNA using Lipofectamine™ 2000 transfection reagent (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Individual point mutations of wt TatABC or H3 were introduced using Quik-change site-directed mutagenesis (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Arpin WT and mutants W195D and I199D/M200D were obtained using the QuikChange Lightning mutagenesis kit (Agilent). Full length ORFs encoding Arpin WT and mutants W195D and I199D/M200D were cloned in our custom-made plasmid (MXS EF1Flag Blue2 SV40pA PGK Blasti bGHpA ...