Labshake search
Citations for Agilent :
451 - 500 of 1876 citations for Small Airway Epithelial Cell since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: AD-293 (HEK) cells were purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Physiology 2020Quote: ... Positive cells were labeled by DAB chromogen (DAKO) for 5 minutes ...
-
bioRxiv - Immunology 2020Quote: ... Seahorse XF Cell Mito Stress Test (Agilent Technologies) was used following manufacturer’s indications ...
-
bioRxiv - Biophysics 2019Quote: The human embryonic kidney AD-293 cells (Agilent) were cultured in growth medium that consisted of Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Biochemistry 2019Quote: ... coli BL21 DE3 RIL (codon plus) cells (Stratagene). All cDNA plasmids ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were mounted in mounting medium (DAKO, S3023). 3D stacks of confocal images were acquired with 60X NA1.3 water lens on a Nikon Eclipse Ti Microscope equipped with Yokogawa CSU-X1 spinning disc unit ...
-
bioRxiv - Cell Biology 2021Quote: ... A Moflo high-speed cell sorter (Dako Cytomation) was used ...
-
bioRxiv - Cell Biology 2021Quote: ... coli BL21(DE3) competent cells from Agilent (200131) or Thermo Scientific (EC0114) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were sequentially treated with 1μM oligomycin (Agilent), 1μM FCCP (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... BL21dLacGold cells (Didovyk et al., 2017) (Agilent, 230132), or the CRISPR+ ...
-
bioRxiv - Biophysics 2020Quote: ... coli and purified from BL21-CodonPlus cells (Agilent) as described previously (14) ...
-
bioRxiv - Cancer Biology 2022Quote: After coating Seahorse XFe24 Cell Culture Microplates (Agilent) with Poly-D-lysine hydrobromide (FUJIFILM Wako Pure Chemical) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were mounted in Fluorescent Mounting Medium (DakoCytomation) supplemented with Hoechst 33342 ...
-
bioRxiv - Biophysics 2022Quote: ... coli BL21(DE3) Codon Plus RIL cells (Agilent) as described previously with minor modifications (119) ...
-
bioRxiv - Biochemistry 2022Quote: ... coli BL21(DE3)-RIL CodonPlus cells (Agilent Technologies) and grown in LB media containing appropriate antibiotics ...
-
bioRxiv - Biophysics 2022Quote: ... coli B21-CodonPlus (DE3)-RIPL competent cells (Agilent). MSP1D1 contains a N-terminal 6xHis tag that can be removed by TEV protease ...
-
bioRxiv - Biophysics 2023Quote: ... coli BL21 (DE3)-gold cells (Agilent Technologies, USA), as described 52 ...
-
bioRxiv - Biochemistry 2023Quote: ... E.coli XL-10 cells were provided by STRATAGENE EUROPE.
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 DE3 RIL (codon plus) cells (Stratagene). All cDNA plasmids ...
-
bioRxiv - Biochemistry 2023Quote: ... prior to transformation into DH5ɑ competent cells (Agilent). Successful mutation of isolated clones was verified by Sanger sequencing and clones were retransformed into BL21-CodonPlus (DE3)-RP competent cells (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: The Seahorse XF Cell Mito Stress Test (Agilent) was performed as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Cell proliferation was measured on xCELLigence® (Agilent) E-Plate VIEW (96 wells ...
-
bioRxiv - Cell Biology 2023Quote: ... chemically competent BL21-CodonPlus (De3) cells (Agilent Technologies) were transformed with the respective pET-28 vector via 42°C heat shock and plated overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) were used ...
-
bioRxiv - Biophysics 2023Quote: ... was transformed into Escherichia coli BL21 cells (Agilent). Cells were grown and protein expression was induced by the addition of 0.2 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Bioengineering 2023Quote: ... coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with 100 µg/mL of ampicillin (amp100 ...
-
bioRxiv - Bioengineering 2023Quote: ... Coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with amp100 and 1% glucose at 37 °C and 250 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with amp100 and 1% glucose at 37 °C and 250 rpm ...
-
bioRxiv - Cancer Biology 2023Quote: ... Seahorse XF96 Cell Culture Microplates (101085; Agilent Technologies) were treated with Cell-Tak Cell and Tissue Adhesive (354240 ...
-
bioRxiv - Genetics 2023Quote: ... coli Arctic Express (DE3) cells (Agilent Technologies Inc.) transformed with the mouse RNF212B-6xHis expression vector were grown in 2L of LB at 30°C to an OD600 of 0.8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were washed once with Rinse solution (Dako) at room temperature for 10 seconds ...
-
bioRxiv - Cell Biology 2023Quote: ... and transformed into XL10 Gold competent cells (Agilent). Bsp11-407 was amplified using primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgccgtttcttcaggttattcc ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were mounted with fluorescence mounting medium (DAKO). Images were captured by a Zeiss Axio Imager Z1.
-
bioRxiv - Cell Biology 2024Quote: AD293 cells (Cat # 240085, Agilent, Santa Clara, USA) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2024Quote: ... BL21-CodonPlus (DE3)-RIPL competent cells (Agilent, 230280) are transformed with sequence-validated vectors ...
-
bioRxiv - Immunology 2024Quote: ... a Seahorse cell culture 96 well-plate (Agilent) was coated with 50μL/well of 50 μg/mL Gibco Poly-D-lysine (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Unbound antibody was removed with washing buffer and the fraction of cells with surface protein labeled with CD44 antibody was determined using a MoFlo cell sorter (Dako Cytomation).
-
bioRxiv - Cell Biology 2019Quote: We assessed the respiratory capacity of NPKO and control cells using the Cell Mito Stress Test Kit (Agilent Cat. #103010-100) on the Agilent Seahorse XFp instrument ...
-
bioRxiv - Cell Biology 2021Quote: ... MSCs were seeded at a density of 10,000 cells/well in a XF96 cell culture 96-well microplate (Agilent 101085-004) precoated with 10 µg/ml of fibronectin (Sigma F1141) ...
-
bioRxiv - Immunology 2021Quote: ... SC-macrophages or SC-macrophages treated with 10 nM RvD1 as above were seeded (30,000 cells/well) on a Seahorse XF96 cell culture plate (Agilent, #102601-100). The cells were incubated in glucose-free ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa and MDA-MB-231 cells were plated accordingly as low (50% confluency) and high (100% confluency) density cultures in 24 well cell plates (Seahorse bioscience) in DMEM growth medium containing 10% FBS and placed in a 5% CO2 incubator ...
-
bioRxiv - Neuroscience 2020Quote: ... HAP1 (40,000 cells/well) and DU145/Rho0 (30,000 cells/well) were plated on Agilent Seahorse XF96 V3-PS Microplates (Agilent 101085-004) approximately 24 hours before stress tests ...
-
bioRxiv - Cancer Biology 2020Quote: ... we plated A101D and MeWo cells at 30,000 live cells per well in a 96-well plate (Agilent, Santa Clara, CA). Cells were plated in either control or homocysteine media and incubated for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... Single-cell clones were made for each strain by depositing epimastigotes into a 96-well plate at a density of 0.5 cell/well by using a MoFlow cell sorter (Dako-Cytomation, Denmark). One healthy clone that has confirmed to have cycled through all life stages was chosen for sequencing for each strain ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell lines were karyotyped after in-house expansion by Cell Line Genetics using array comparative genomic hybridization (aCGH, Agilent 60K Standard). Limited chromosomal imbalances in non-critical genes were reported ...
-
bioRxiv - Immunology 2023Quote: ... Cells were resuspended at a concentration of 8×106 cells/ml in Seahorse XF Base Medium (Agilent Technologies, Santa Clara, CA) supplemented with 1 mM pyruvate ...
-
bioRxiv - Cell Biology 2022Quote: ... were assessed using the XF96 Extracellular Analyzer as described in manufacturer’s instructions for the XF cell mito stress and the XF cell mito fuel flex test kits (Agilent Technologies, CA).Briefly ...
-
LSD1 inhibition improves efficacy of adoptive T cell therapy by enhancing CD8+ T cell responsivenessbioRxiv - Immunology 2023Quote: Seahorse experiments were performed on sorted CD8+ cells activated in presence or absence of LSDi using XF Cell Mito Stress kit (Seahorse Bioscience). OCR and ECAR were measured with XF96 Extracellular Flux Analyzers (Seahorse Bioscience) ...
-
bioRxiv - Physiology 2024Quote: Fuel preference of CRISPR/Cas9 Pparγ edited cells (γY4KO) and mock-edited cells (C) was measured using Seahorse Mito-Fuel Flex test (Agilent Technologies), in assay medium as above and according to the manufacturer protocol ...
-
bioRxiv - Physiology 2024Quote: ... The function of mitochondria was assessed in isolated acinar cells by measurement of oxygen consumption rate (OCR) employing a Seahorse XF Cell Mito Stress Test system (Agilent, USA). Briefly ...