Labshake search
Citations for Agilent :
1 - 50 of 657 citations for SEMA3A Human HEK293 His Flag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... human embryonic kidney cells 293 (HEK293; Agilent #240073) were calcium phosphate-transfected with the recombinant AAV2 plasmid and a 3-helper system ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected into HEK293 cells (AAV293, Stratagene). After 3 days ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected into HEK293 cells (AAV293, Stratagene). After three days ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human SLFN14 D249A was generated by site directed mutagenesis with the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) using reverse primer SS1 (5’-atccaccccaatgaggacatatcc-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... We performed exome sequencing in the child with neonatal diabetes and his consanguineous parents using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb). We analyzed the data with our established pipeline in the institute (Kuhnen ...
-
bioRxiv - Developmental Biology 2023Quote: ... We performed exome sequencing in the child with diabetes and his consanguineous parents and sibling using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb) and next-generation sequencing (Hiseq ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Neuroscience 2019Quote: ... and RepCap5 (Applied Viromics) were transfected to HEK293 cells (AAV293, Stratagene). After 3 days of incubation ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Respirometry on HEK293 cells were performed on a SeaHorse XF Pro (Agilent) using the real-time ATP rate assay kit (103591-100 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... GIT2(ΔE)/Flag and the double-deletion GIT2(ΔBCE)/Flag using the QuikChange mutagenesis kit (Stratagene). The ΔBC primers were 5’- ACTGCAAGCAAAACAAACCGGCAGAAGCTTCAAACACTCCAGAGTGAAAATTCG and 5’- GCAATTTTCACTCTGGAGTGTTTGAAGCTTCTGCCGGTTTGTTTTGCTTGCAGT to delete amino acids 415-464 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 μL of AccuScript Hi-Fi (Agilent Technologies) was added up to a 10 μL volume ...
-
bioRxiv - Microbiology 2022Quote: ... A 300×7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Genomics 2023Quote: ... were used to assess the Hi-C libraries (Agilent). The libraries were sequenced at New York Genome Center (NYGC ...
-
bioRxiv - Systems Biology 2023Quote: ... A 300 × 7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-FLAG (#200474) was from Agilent. Anti-MAPK4 antibody was purchased from ABGENT (#7298b).
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vector was produced using HEK293 T-cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15 cm dishes (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vectors were produced using HEK293 T cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15-cm dishes (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV plasmids were co-transfected with a pDP6 helper plasmid into HEK293-AAV cells (Agilent). Cells were lysed 72 h after transfection and viral particles were purified using Iodixanol gradient followed by separation ion-exchange chromatography (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-FLAG (Agilent, 1:800 dilution), rabbit anti-V5 (GenScript ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Microbiology 2024Quote: ... and a 300×7.8 mm Hi-Plex Exchange column (Agilent, USA) was used to quantify glucose ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated overnight at 4°C with primary antibodies (rabbit anti-TMEM98, Proteintech, 1:1000; rabbit anti-FLAG polyclonal, Sigma, 1:2000; mouse anti-FLAG monoclonal M2, Stratagene 1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... and pCMVTag 4 expression control plasmid containing the firefly luciferase gene fused with the FLAG tag (luc-FLAG) were obtained from Stratagene. The plasmid 15cxCAT contained the interleukin-2 (IL-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... bound to monoclonal anti-Flag antibody (Agilent Technologies) for 5 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: The MAPK/ERK pathway was assayed in HEK293 cells with the Elk1 trans-reporting system (PathDetect, Agilent). HEK293 cells were maintained in DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2 viruses were produced by large-scale triple CaPO4 transfection of HEK293-AAV cells (#240073, Stratagene) as described previously (Van Loo et al. ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: ... AAV9-CAG-tdTomato and AAV-KP1-CAG-tdTomato were produced in HEK293 cells (RRID: CVCL-6871, Agilent) by an adenovirus-free plasmid transfection method and purified by two rounds of cesium chloride density-gradient ultracentrifugation followed by dialysis as described previously.53 AAV9 and AAV-KP1 helper plasmids were provided by J ...
-
bioRxiv - Molecular Biology 2020Quote: The plasmid pUHD-FLAG-H3.3K56R and pUHD-FLAG-H3.3K56Q were constructed using a Quick Change II Site-Directed Mutagenesis Kit (Agilent, CA, United States), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... A rat anti-FLAG mAb was purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Pathology 2020Quote: ... The self-complementary scAAV9-CB-SMN vector was produced by calcium phosphate transfection of HEK293-AAV cells (Agilent) with pAAV-CB-SMN[57] and pDF9 plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA synthesis was performed using Accuscript Hi Fidelity First Strand Synthesis kit (Agilent). The amount of RNA entered into the reaction was normalised between samples ...
-
bioRxiv - Cell Biology 2021Quote: ... The mGli2-His recombinant protein was expressed in BL21 (DE3) pLysS cells (Stratagene) and purified under denaturing condition (8 M urea ...
-
bioRxiv - Molecular Biology 2019Quote: pTrex-6×His-TOP1Y723F was generated by QuikChange II XL SDM kit (Agilent) using oligonucleotides 5’-CTAGGGTCCAGAAAATTGAGTTTGGAGGTTCCCAGG-3’ pTrex-6×His-TOP1 K117 ...
-
bioRxiv - Neuroscience 2021Quote: ... shuttle plasmids were co-transfected with the pDF9 helper plasmid into HEK293-AAV cells (Agilent Technologies, Santa Clara, USA). Cells were lysed 72h following transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Flag-ErbB3 cDNA was subjected to site-directed mutagenesis (Agilent) to generate LL866/7AA mutant Flag-ErbB3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rat monoclonal to flag tag (Agilent Cat# 200474, RRID:AB_10597743). The monoclonal to Xenopus laevis Sox3 (DSHB Cat# DA5H6 ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned and inserted into pCMV5-FLAG vector (Agilent Technology). The mouse SVZ cDNA was prepared as described in the ‘qPCR analysis of migrating neurons’ section ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-Trabid mutants generated by site-directed mutagenesis (QuikChange, Agilent), pEGFP-C1-APC (Rosin-Arbesfeld et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections of human tumors were stained with mouse anti-human CD68 (Dako) and goat anti-human TSP-4 (AF2390 ...
-
bioRxiv - Systems Biology 2019Quote: ... and human TTR (Dako) with standard curves of purified human RBP4 (72 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human universal RNA (Agilent) was used as a reference to standardise results between QPCR batches.
-
bioRxiv - Genomics 2019Quote: ... The concentration of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies), and the Hi-C libraries were paired-end sequenced (HiSeq 2500 ...
-
bioRxiv - Biochemistry 2021Quote: ... and the reaction was stopped by adding 2X GE HI-RPM hybridization buffer (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Mutations were introduced into Flag-CinBwNo in p416GAL1 by Quikchange (Agilent; mutagenesis using primers listed in Supplementary Table 2).
-
bioRxiv - Cancer Biology 2021Quote: ... Quantity and integrity of the Hi-C libraries was determined by Bioanalyzer profiles (Agilent Technologies).
-
bioRxiv - Microbiology 2022Quote: ... the stationary phase was a Hi-Plex H column (300 x 7.7 mm; Agilent, USA) and the mobile phase was 0.005 M H2SO4 solution at a flow rate of 0.4 ml/min ...