Labshake search
Citations for Agilent :
1 - 50 of 1658 citations for Recombinant Mouse SHH Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... a Bgl2 site was introduced into SHH-FL after Gly198 by Quikchange (Agilent) using primers (forward 5’ GTGGCGGCCAAATCCGGCGGCAGATCTGGCTGTTTCCCGGGATCCGCC and reverse 5’ ggcggatcccgggaaacagccagatctgccgccggatttggccgccac) ...
-
bioRxiv - Cell Biology 2021Quote: ... The mGli2-His recombinant protein was expressed in BL21 (DE3) pLysS cells (Stratagene) and purified under denaturing condition (8 M urea ...
-
bioRxiv - Microbiology 2022Quote: ... Missense mutations in recombinant proteins were generated by QuikChange site-directed mutagenesis (Agilent) using the respective pET28b derivatives as templates ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant proteins were expressed in Escherichia coli BL21-CodonPlus (DE3)-RIL cells (Agilent) in LB medium at 16 °C overnight and protein expression was induced by 0.25 mM IPTG (final concentration ...
-
bioRxiv - Microbiology 2020Quote: Intrinsic tryptophan fluorescence of recombinant protein was measured using a Cary Eclipse Spectrophotometer (Agilent) and Jasco FP-8500 Spectrofluorometer ...
-
bioRxiv - Biochemistry 2019Quote: ... The recombinant proteins were overexpressed in E coli BL21 (DE3) Codon plus RIL (Stratagene) at 15 °C and purified by affinity chromatography on Ni-nitrilotriacetate resin (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... Recombinant PA-Tnp protein was expressed in BL21-Gold(DE3) competent cells (Agilent cat # 230132) and purified using nickel beads ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant proteins were expressed using E.coli BL21 (DE3) RIL according to the manufacturer’s protocol (Stratagene). The recombinant fusion proteins were purified via affinity chromatography from bacterial extracts using amylose resin (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: For expression of recombinant proteins (listed in Table S1) we used ArcticExpress (DE3) bacteria (Agilent) or SF9-ESF S ...
-
bioRxiv - Microbiology 2020Quote: ... biotinylated recombinant TRAP proteins (Table 1) were oligomerized around a streptavidin-conjugated Phycoerythrin (PE) (PJRS2, Prozyme) creating TRAP-PE staining complexes ...
-
bioRxiv - Neuroscience 2019Quote: ... Recombinant proteins were expressed in BL21-CodonPlus (DE3)-RILP Competent Cells (Agilent Technologies, Santa Clara, CA) and purified using Glutathione Sepharose 4B Media (GE Healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... All recombinant proteins were expressed in the BL21-Gold (DE3) pLysS strain of Escherichia coli (Agilent) in pGEX-KG vectors as glutathione S-transferase (GST ...
-
bioRxiv - Biochemistry 2022Quote: ... Product titer was analyzed offline from spent media daily by protein A chromatography on the Agilent Bioinert 1260 HPLC system using a Bio-Monolith Recombinant Protein A column (Agilent Technologies, Santa Clara, CA). An XCell™ ATF system (Repligen ...
-
bioRxiv - Biochemistry 2023Quote: Titer analysis of spent medium was analyzed offline daily by Protein A chromatography on an Agilent Bioinert 1260 HPLC system using a Bio-Monolith Recombinant Protein A column (Agilent Technologies, Santa Clara, CA) as well as with the BLItz biolayer interferometer system (ForteBio ...
-
bioRxiv - Cell Biology 2021Quote: All recombinant proteins were expressed in either BL21-CodonPlus (DE3)-RIPL or ArcticExpress (DE3) competent cells (Agilent Technologies) grown in LB medium overnight at 13-16°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins (GST, GST-BZR1, GST-PIF3 and GST-H2A) expressed in BL21- CodonPlus (DE3)-RIL (Agilent Technologies) were purified using glutathione beads ...
-
bioRxiv - Cell Biology 2019Quote: ... All the mutant versions of recombinant proteins were produced by QuickChange Mutagenesis kit to mutate the plasmid DNA (Agilent Technologies). The MAD1 fragments and Cyclin B1 were transformed into BL21(DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: 100 μL of purified recombinant protein (at approximately 2 mg/mL) were loaded onto a sizeexclusion chromatography column (PL1580-3301, Agilent) in the phosphate buffer (20 mM Tris ...
-
bioRxiv - Genetics 2024Quote: Recombinant adenoviruses expressing mouse SAR1A or SAR1B were constructed using pAdTrack-CMV and the AdEasy adenoviral vector system (Agilent Technologies, Lexington MA). Adenoviruses were amplified in Ad293 cells and purified using CsCl gradient ultracentrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... and mouse myelin basic protein antibody (anti-MBP, 1:500, Dako, Glostrup, Denmark), respectively for 24 hours at 4 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... elegans PGL-3 NtDD wild type and mutant recombinant protein were determined by conducting SEC-MALS experiments using Agilent Technologies 1260 LC HPLS system (Agilent Technologies, Santa Clara, CA) equipped with Dawn® Heleos™II 18-angle MALS light scattering detector ...
-
bioRxiv - Biophysics 2022Quote: ... Recombinant plasmids were transformed in XL1Blue (Agilent Technologies) or Top10 (Thermofisher scientific ...
-
bioRxiv - Biophysics 2019Quote: ... Recombinant human tropomyosin was purified from BL21-CodonPlus (Agilent) using established protocols (91 ...
-
bioRxiv - Biochemistry 2023Quote: ... All recombinant plasmids were transformed into XL1-Blue competent cells (Agilent) and sequenced for verification.
-
bioRxiv - Cell Biology 2019Quote: ... Protein lysates were incubated at 4°C with a mouse monoclonal antibody directed against the FLAG-tag (M2, Stratagene). Immunocomplexes were pulled down by incubation with protein G sepharose ...
-
bioRxiv - Immunology 2021Quote: ... and Protein block (Protein block (Dako) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... pShuttleCMV-Bub1K795R was used to generate recombinant adenoviruses using the AdEasy system (Stratagene), according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies). The produced adenoviruses were purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies) and purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Pathology 2023Quote: ... mouse IgG2a anti-mouse αSMA (Dako, M851), rabbit anti-mouse vimentin (Cell Signaling ...
-
bioRxiv - Biophysics 2020Quote: ... The recombinant construct was transformed into Arctic express (DE3) competent cells (Agilent Technologies, USA). The transformed cells were grown at 37°C in LB media supplemented with 100 μg/ml ampicillin and 10 μg/ml gentamycin ...
-
bioRxiv - Biophysics 2019Quote: ... The recombinant plasmid was subsequently transformed into Escherichia coli BL21 (DE3) cells (Agilent Technologies) for protein expression ...
-
bioRxiv - Biophysics 2023Quote: ... The resultant recombinant plasmids were transformed into ultra-competent ArcticExpress (DE3) cells (Agilent Technologies). ArcticExpress cells are derived from BL21(DE3) ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein blocking was performed using protein block solution (DAKO) for 30 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Mouse (Dako) was used to visualize antibody immunoreactivity ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vector was produced using HEK293 T-cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15 cm dishes (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV recombinant vectors were produced using HEK293 T cells (AAV293; 240073, Agilent Tech, CA, USA) cultured in 15-cm dishes (Corning ...
-
bioRxiv - Molecular Biology 2022Quote: Recombinant production/purification: The MLucV construct was expressed in BL21-CodonPlus (DE3)-RIPL strain (Agilent) using ampicillin and chloramphenicol as the selection antibiotic ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylated recombinant NS1 was purified by FPLC and then tetramerized to fluorochrome-conjugated streptavidin (Prozyme). To detect NS1-specific B cells ...
-
bioRxiv - Biophysics 2023Quote: Recombinant Pil1 and Pil1-mCherry were expressed in BL21(DE3)pLysS (#200132, Agilent Technologies Inc.) in auto induction LB medium (#AIMLB0210 ...
-
bioRxiv - Bioengineering 2023Quote: ... protein block with Dako protein block solution (Dako, Glostrup, Denmark), incubation with primary antibodies [eGFP (Abcam ...
-
bioRxiv - Cancer Biology 2019Quote: ... protein block (Dako) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Protein Block (Agilent) was used to block nonspecific antibody binding before incubating the sections with primary antibody overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... the recombinant adenovirus vector was produced using AdEasy (Ad) Vector System (Stratagene, La Jolla, CA, USA). The infection controls were Ad-GFP.
-
bioRxiv - Microbiology 2020Quote: ... Rabbit/Mouse (Agilent). This staining procedure can be used for sequential double staining of two different antigens with primary antibodies raised in the same species by incorporating a blocking step between the first and second antibody incubations ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit/mouse (Dako) was used to visualize the antibody staining ...
-
bioRxiv - Immunology 2024Quote: ... Rabbit/Mouse (Agilent) and counterstained with hematoxylin (Wako) ...
-
bioRxiv - Cell Biology 2021Quote: ... and recombinant adenovirus particles were produced following the AdEasy XL Adenoviral Vector System protocol (#240010 Agilent Technologies). Islets were transduced using a microfluidic device to obtain uniform infection of the islet cells throughout the islet volume and were incubated overnight before imaging ...
-
bioRxiv - Immunology 2020Quote: ... protein block (Dako X0909) for 20 minutes at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... and Protein block (Dako) before staining with anti-pS6 (detected with fluorochrome conjugated secondary antibodies ...