Labshake search
Citations for Agilent :
1 - 50 of 1717 citations for Recombinant Human Ribulose 5 Phosphate 3 Epimerase His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Cell Biology 2021Quote: ... The mGli2-His recombinant protein was expressed in BL21 (DE3) pLysS cells (Stratagene) and purified under denaturing condition (8 M urea ...
-
bioRxiv - Biophysics 2019Quote: ... Recombinant human tropomyosin was purified from BL21-CodonPlus (Agilent) using established protocols (91 ...
-
bioRxiv - Biochemistry 2022Quote: ... constructs containing DNA encoding 8X-His-tagged CHI-domain-containing proteins were transformed into BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent) for recombinant protein expression ...
-
bioRxiv - Biochemistry 2023Quote: The pET-30a-PHB1 vector encoding His-tagged mouse PHB1 was transformed into Escherichia coli strain BL21 Star (DE3; Stratagene). The resulting N-terminal His-tagged recombinant PHB1 was purified using Ni-Sepharose 6 Fast Flow (GE Healthcare) ...
-
bioRxiv - Immunology 2023Quote: ZIKV NS2B-NS3pro recombinant constructs with N-terminal His tag were used to transform competent E.coli BL21 (DE3) Codon Plus cells (Stratagene). Transformed cells were grown at 30°C in LB broth containing carbenicillin (0.1 mg/ml) ...
-
bioRxiv - Microbiology 2021Quote: ... The 5-AIQC-tagged samples (1 μL) were individually injected on an UPLC column (Agilent ZORBAX RRHD Eclipse XDB C18 column ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human SLFN14 D249A was generated by site directed mutagenesis with the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) using reverse primer SS1 (5’-atccaccccaatgaggacatatcc-3’ ...
-
bioRxiv - Microbiology 2022Quote: All of the indicated mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) (66) ...
-
bioRxiv - Microbiology 2019Quote: All of the mutations were introduced into a plasmid backbone expressing His6 tagged pNL4-3-derived IN by QuikChange site directed mutagenesis kit (Agilent) [60] ...
-
bioRxiv - Biochemistry 2024Quote: All of the mutations were introduced into a plasmid backbone expressing 6xHis tagged pNL4-3-derived IN by QuikChange site-directed mutagenesis kit (Agilent). The plasmids containing full-length WT and mutants were transformed into BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cell Biology 2021Quote: ... We performed exome sequencing in the child with neonatal diabetes and his consanguineous parents using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb). We analyzed the data with our established pipeline in the institute (Kuhnen ...
-
bioRxiv - Developmental Biology 2023Quote: ... We performed exome sequencing in the child with diabetes and his consanguineous parents and sibling using the Agilent SureSelect Human All Exon Kit (Agilent SureSelect v4, 50Mb) and next-generation sequencing (Hiseq ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies tagged with Horse Radish Peroxidase (HRP; Dako) were incubated for 1 h at room temperature under rotation ...
-
bioRxiv - Immunology 2024Quote: ... a biotin-tagged polyclonal anti-C1q Ab (Agilent, A0136) was incubated for 1 hr at RT followed by HRP-coupled streptavidin 1:10000 and TMB One.
-
bioRxiv - Immunology 2021Quote: ... beads were incubated with 5 μg/ml FITC-conjugated rabbit anti-human C1q (Dako, F0254).
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were blocked with 5 μg/ml human immunoglobulins solved in blocking serum-free medium (Dako) for 30 minutes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 μL of AccuScript Hi-Fi (Agilent Technologies) was added up to a 10 μL volume ...
-
bioRxiv - Microbiology 2022Quote: ... A 300×7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Genomics 2023Quote: ... were used to assess the Hi-C libraries (Agilent). The libraries were sequenced at New York Genome Center (NYGC ...
-
bioRxiv - Systems Biology 2023Quote: ... A 300 × 7.8 mm Hi-Plex HPLC Column (Agilent) was equilibrated with 5 mM H2SO4 in HPLC grade water at 55° at a 0.8 mL/min flow rate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Genomics 2019Quote: The FLNC reads from the Isoseq3 refine step were error corrected using Lordec (-k 31 -s 3) with short read RNAseq data from the Universal Human Reference RNA (Agilent) (https://www.ncbi.nlm.nih.gov/sra/SRX1426160 ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... After three washes with phosphate-buffered saline (PBS) (DAKO), primary antibody was incubated for 30 minutes at room temperature ...
-
bioRxiv - Pathology 2023Quote: ... After three washes with phosphate-buffered saline (PBS) (DAKO), primary antibody was incubated for 30 minutes at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... hexahistidine-tagged IN was overexpressed in BL-21 CodonPlus RIL cells (Agilent). Cells were lysed in 25 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dual-tagged Slit2 Δ construct was obtained by Quickchange mutagenesis procedure (Agilent), deleting 9 amino acids (SPPMVLPRT ...
-
bioRxiv - Biophysics 2022Quote: ... Recombinant plasmids were transformed in XL1Blue (Agilent Technologies) or Top10 (Thermofisher scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Next day membranes were washed for 3 x 5 min and incubated with HRP-coupled secondary antibodies (DAKO) diluted 1:3000 in washing buffer for 1.5 hour at RT ...
-
bioRxiv - Genetics 2023Quote: ... slides were carefully rinsed 3 × 5 min with PBS and slides were mounted with Fluorescent Mounting Medium (Dako) and examined under fluorescence using a Zeiss microscope equipped with an AxioCam HRm camera.
-
bioRxiv - Microbiology 2024Quote: ... and a 300×7.8 mm Hi-Plex Exchange column (Agilent, USA) was used to quantify glucose ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...