Labshake search
Citations for Agilent :
1 - 50 of 588 citations for Recombinant Human CD40 Fc Chimera since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Recombinant human tropomyosin was purified from BL21-CodonPlus (Agilent) using established protocols (91 ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1 μg/mL recombinant anti-PSD95 antibody (Rabbit Fc fusion, NanoTag Biotechnologies #N3783) diluted in Dako REAL Antibody Diluent (S2022, Agilent) for 1 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... ScFv-Fc were revealed thanks to a polyclonal α-human IgG HRP-conjugated Ab (P0214, Dako), diluted 1:10000 ...
-
bioRxiv - Neuroscience 2019Quote: ... and m-aSyn Chimera N87S were generated via site-directed mutagenesis using the QuikChange method (Stratagene). The sequence of the DNA insert in each bacterial expression construct was verified using an Applied Biosystems (ABI3700 ...
-
bioRxiv - Genetics 2022Quote: The wild-type and mutant BRD-1-BRC-1 chimeras were expressed in BL21-CodonPlus (DE3)-RIPL cells (Agilent). The cells were grown at 37°C until OD600 0.6 and were induced by 0.2mM isopropyl-β-D-thiogalactoside in the presence of 100μM ZnCl2 at 37°C for 6 hrs ...
-
bioRxiv - Neuroscience 2020Quote: ... conversion of both the pre TM1 and the TM2-TM3 loop from the chimera to the corresponding α9 sequence was performed by QuikChange Multi Site-Directed Mutagenesis kit (Stratagene) using primers 5’GGCATGCTCTCGGCCACCATCAGCTGGAAGACGG3’ and 5’GGGCAGCAGGAGGTTGACGATGTAGAATGAAGAGCGGCGCTTCAG3’ ...
-
bioRxiv - Biophysics 2021Quote: ... the double-mutant S11N/G74S variant and the chimera involving the loop [70-77] were introduced using the QuikChange Lighting Site-Directed Mutagenesis kit (Agilent Technologies) and the sequences were confirmed by DNA sequencing ...
-
bioRxiv - Immunology 2022Quote: E382R/S/A mutations were introduced into IgG1 Fc encoded within a pFUSE-hIgG1-Fc vector using site-directed mutagenesis (QuikChange II kit, Agilent), using mutagenic primers (Supplementary Table 4 ...
-
bioRxiv - Biophysics 2022Quote: ... Recombinant plasmids were transformed in XL1Blue (Agilent Technologies) or Top10 (Thermofisher scientific ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies, United States) according to the manufacturer’s instructions and the respective parental vector as template ...
-
bioRxiv - Cancer Biology 2023Quote: ... After performing Fc block by using blocking buffer (Dako, X0909), cells were stained by CD24 (Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections of human tumors were stained with mouse anti-human CD68 (Dako) and goat anti-human TSP-4 (AF2390 ...
-
bioRxiv - Biochemistry 2023Quote: ... All recombinant plasmids were transformed into XL1-Blue competent cells (Agilent) and sequenced for verification.
-
bioRxiv - Cell Biology 2020Quote: ... incubated with a rabbit antibody against mouse Fc fragment (Dako Agilent Z0412) in PBS 0,1% BSA for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated with a rabbit antibody against mouse Fc fragment (Dako Agilent Z0412) in PBS 0,1% BSA for 20 min at room temperature ...
-
bioRxiv - Systems Biology 2019Quote: ... and human TTR (Dako) with standard curves of purified human RBP4 (72 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human universal RNA (Agilent) was used as a reference to standardise results between QPCR batches.
-
bioRxiv - Immunology 2021Quote: ... mouse anti-human CD3 (Dako) and mouse anti-HIV-1 P24 (Dako) ...
-
bioRxiv - Immunology 2021Quote: ... FITC anti-human CD44 (DAKO), Purified NA/LE mouse anti-human CD253 (BD Biosciences) ...
-
bioRxiv - Microbiology 2020Quote: Universal Human Reference RNA (Stratagene) was treated with RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD8 (DAKO), and mouse anti-human TAG72 (AB16838 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD3 (DAKO), mouse anti-human CD4 (DAKO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-human CD4 (DAKO), mouse anti-human CD8 (DAKO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human universal total RNA (Agilent) was used as a positive control ...
-
bioRxiv - Immunology 2023Quote: ... For human CD45 (Dako, M0701), CD19 (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary incubation was performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412), then grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary incubation was performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412), then grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Microbiology 2020Quote: ... ACE2-Fc variants were generated by the QuikChange II site-directed mutagenesis protocol (Agilent).
-
bioRxiv - Immunology 2021Quote: ... washed twice with PBS/2% FCS and stained with PE (Prozyme, 20 µg/ml). RNA flow cytometry measurement of Bhlhe40 expression was performed using the PrimeFlow RNA Assay (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: The library of the extracted genomic DNA was prepared by Illumina Nextera XT DNA Library Prep Kit protocol (# FC-131-1096) and analyzed by Agilent D1000 ScreenTape ...
-
bioRxiv - Cell Biology 2020Quote: ... pShuttleCMV-Bub1K795R was used to generate recombinant adenoviruses using the AdEasy system (Stratagene), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The mGli2-His recombinant protein was expressed in BL21 (DE3) pLysS cells (Stratagene) and purified under denaturing condition (8 M urea ...
-
bioRxiv - Biophysics 2021Quote: Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies). The produced adenoviruses were purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... Missense mutations in recombinant proteins were generated by QuikChange site-directed mutagenesis (Agilent) using the respective pET28b derivatives as templates ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant adenoviruses were produced using the AdEasy XL Adenoviral Vector System (Agilent Technologies) and purified using the AdEasy Virus Purification Kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant proteins were expressed in Escherichia coli BL21-CodonPlus (DE3)-RIL cells (Agilent) in LB medium at 16 °C overnight and protein expression was induced by 0.25 mM IPTG (final concentration ...
-
bioRxiv - Biochemistry 2020Quote: Human ISG15 cDNA was amplified by RT-PCR from universal human reference RNA (Agilent 740000-41), adding BamHI and NotI restriction sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Cell Biology 2023Quote: Non-codon optimised sequences were amplified from a human cDNA library (MegaMan human transcription library, Agilent). Mis18α ...
-
bioRxiv - Genomics 2019Quote: ... SureSelect Human All Exon V6 (Agilent), and the Human Core Exome Kit + RefSeq V1 (Twist) ...
-
bioRxiv - Pathology 2019Quote: ... and mouse anti-human CD31 (DAKO) was applied overnight at 4°C ...
-
bioRxiv - Genetics 2021Quote: ... Universal Human Reference RNA (UHRR, Agilent) was spiked into each of the samples for a final RNA amount of 300 ng to balance the RNA concentrations in the pools ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-human tau (Dako, 1:10,000), the phosphorylation specific anti-tau antibody Ser396/Ser404 (PHF1 ...
-
bioRxiv - Neuroscience 2019Quote: ... total tau (total human tau, Agilent), Tau-1 (Millipore) ...
-
The heterogeneity of the DNA damage response landscape determines patient outcomes in ovarian cancerbioRxiv - Cell Biology 2021Quote: ... SureSelect Human All Exon V6 (Agilent) exome libraries were prepared and samples were paired-end whole exome sequenced (WES ...
-
bioRxiv - Developmental Biology 2021Quote: ... SureSelectXT Human All Exon Kits (Agilent) or Human Core Exome (Twist Bioscience ...
-
bioRxiv - Cancer Biology 2021Quote: ... human CD45 (Dako M0701, 1:100), and human CD20 (Dako M0755 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human vimentin (1:4000; M0725, DakoCytomation), breast cancer resistance protein (BCRP ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary incubation was next performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412). Grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary incubation was next performed with a rabbit anti mouse Fc fragment (Dako Agilent Z0412). Grids were incubated with Protein A-Gold 10 nm (Cell Microscopy Center ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 20% fetal calf serum (FCS) and incubated with anti-insulin (1/10, Dako) in Antibody Diluent for 2h ...