Labshake search
Citations for Agilent :
1 - 50 of 696 citations for Recombinant Human CD3D Flag and Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged human SLFN14 D249A was generated by site directed mutagenesis with the QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) using reverse primer SS1 (5’-atccaccccaatgaggacatatcc-3’ ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Biophysics 2019Quote: ... Recombinant human tropomyosin was purified from BL21-CodonPlus (Agilent) using established protocols (91 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The Flag-tagged PARP1 R138C mutant was generated by the site-directed mutagenesis Kit (Agilent, La Jolla, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Rat Kir6.1 and N-terminal FLAG-tagged (DYKDDDDK) SUR2B were first cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses in HEK293 cells according to manufacturer’s instructions63,64 ...
-
bioRxiv - Biochemistry 2021Quote: ... Cys to Ala mutants of Flag-tagged DJ-1 were using QuikChange Ⅱ Site-Directed Mutagenesis kit (Agilent Technologies, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with 1 μg/mL recombinant anti-PSD95 antibody (Rabbit Fc fusion, NanoTag Biotechnologies #N3783) diluted in Dako REAL Antibody Diluent (S2022, Agilent) for 1 h at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... The substitution S59D and S59A were introduced into the pLVX-IRES-FLAG-tagged HERPUD1 vector using the QuikChange II XL direct-mutagenesis kit (Stratagene, cat#200522) and the mutagenesis service of GenScript (Hong Kong ...
-
bioRxiv - Biochemistry 2022Quote: ... ScFv-Fc were revealed thanks to a polyclonal α-human IgG HRP-conjugated Ab (P0214, Dako), diluted 1:10000 ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Cancer Biology 2023Quote: ... the plasmids containing the C- and N-terminally His-tagged human ACSS2 DNA were transformed into BL21 (DE3) RIL competent cells (Agilent Technologies, Wilmington, DE) and were expressed in auto-inducing media ZYP-5052 overnight at 15°C with shaking at 225 rpm ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Cell Biology 2022Quote: ... Secondary antibodies tagged with Horse Radish Peroxidase (HRP; Dako) were incubated for 1 h at room temperature under rotation ...
-
bioRxiv - Immunology 2024Quote: ... a biotin-tagged polyclonal anti-C1q Ab (Agilent, A0136) was incubated for 1 hr at RT followed by HRP-coupled streptavidin 1:10000 and TMB One.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... GIT2(ΔE)/Flag and the double-deletion GIT2(ΔBCE)/Flag using the QuikChange mutagenesis kit (Stratagene). The ΔBC primers were 5’- ACTGCAAGCAAAACAAACCGGCAGAAGCTTCAAACACTCCAGAGTGAAAATTCG and 5’- GCAATTTTCACTCTGGAGTGTTTGAAGCTTCTGCCGGTTTGTTTTGCTTGCAGT to delete amino acids 415-464 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-FLAG (#200474) was from Agilent. Anti-MAPK4 antibody was purchased from ABGENT (#7298b).
-
bioRxiv - Immunology 2022Quote: E382R/S/A mutations were introduced into IgG1 Fc encoded within a pFUSE-hIgG1-Fc vector using site-directed mutagenesis (QuikChange II kit, Agilent), using mutagenic primers (Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-FLAG (Agilent, 1:800 dilution), rabbit anti-V5 (GenScript ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Biochemistry 2019Quote: ... hexahistidine-tagged IN was overexpressed in BL-21 CodonPlus RIL cells (Agilent). Cells were lysed in 25 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Dual-tagged Slit2 Δ construct was obtained by Quickchange mutagenesis procedure (Agilent), deleting 9 amino acids (SPPMVLPRT ...
-
bioRxiv - Biophysics 2022Quote: ... Recombinant plasmids were transformed in XL1Blue (Agilent Technologies) or Top10 (Thermofisher scientific ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies, United States) according to the manufacturer’s instructions and the respective parental vector as template ...
-
bioRxiv - Cell Biology 2019Quote: ... and incubated overnight at 4°C with primary antibodies (rabbit anti-TMEM98, Proteintech, 1:1000; rabbit anti-FLAG polyclonal, Sigma, 1:2000; mouse anti-FLAG monoclonal M2, Stratagene 1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... and pCMVTag 4 expression control plasmid containing the firefly luciferase gene fused with the FLAG tag (luc-FLAG) were obtained from Stratagene. The plasmid 15cxCAT contained the interleukin-2 (IL-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... bound to monoclonal anti-Flag antibody (Agilent Technologies) for 5 hours at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... After performing Fc block by using blocking buffer (Dako, X0909), cells were stained by CD24 (Abcam ...
-
bioRxiv - Molecular Biology 2020Quote: The plasmid pUHD-FLAG-H3.3K56R and pUHD-FLAG-H3.3K56Q were constructed using a Quick Change II Site-Directed Mutagenesis Kit (Agilent, CA, United States), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminally His6-tagged KRAS was expressed in BL21-CodonPlus(DE3)-RIL cells (Stratagene) by isopropyl-β-D-1-thiogalactopyranoside induction at 18 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-tagged DCX mutant T203R were created using QuikChange Site-Directed Mutagenesis kit (Stratagene). HA-tagged DCX mutant A71S was synthesized commercially (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: OPG2-tagged ORF3c plasmids were generated by site-directed mutagenesis (Stratagene QuikChange, Agilent Technologies) and confirmed by DNA sequencing (GATC ...
-
bioRxiv - Microbiology 2022Quote: OPG2-tagged ORF3c plasmids were generated by site-directed mutagenesis (Stratagene QuikChange, Agilent Technologies) and confirmed by DNA sequencing (GATC ...
-
bioRxiv - Cell Biology 2023Quote: ... GST-tagged proteins were purified from BL21-CodonPlus (DE3)-RIPL Competent Cells (Agilent, 230280) as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... the CBP-tagged Drp1 was purified by affinity chromatography using calmodulin agarose resin (Agilent) that had been pre-equilibrated with CalA Buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... the CBP-tagged Drp1 was purified by affinity chromatography using calmodulin agarose resin (Agilent) that had been pre-equilibrated with CalA Buffer ...
-
bioRxiv - Immunology 2024Quote: ... C4b deposition was measured using a biotin-tagged anti-C4c polyclonal Ab (Agilent, Q0369) followed by HRP-streptavidin and TMB One ...
-
bioRxiv - Microbiology 2023Quote: ... A rat anti-FLAG mAb was purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Developmental Biology 2019Quote: ... while the MURF1 cDNA fragment was cloned into myc-tagged pCMV-Tag3 (Stratagene, CA, USA). These constructs were sequenced to ensure that no errors were introduced.
-
bioRxiv - Cell Biology 2019Quote: ... GST-tagged Nup153228-611 and Nup50 (full length) were purified from BL21-DE3 (Stratagene 230245) cells as described above.
-
bioRxiv - Microbiology 2021Quote: ... The 5-AIQC-tagged samples (1 μL) were individually injected on an UPLC column (Agilent ZORBAX RRHD Eclipse XDB C18 column ...
-
bioRxiv - Biophysics 2023Quote: Halo-tagged dCas9 protein expression was induced in BL21-CodonPlus(DE3)-RIL cells (Agilent #230245) transformed with pET302-6His-dCas9-halo (Addgene #72269 ...
-
bioRxiv - Cell Biology 2020Quote: ... Flag-ErbB3 cDNA was subjected to site-directed mutagenesis (Agilent) to generate LL866/7AA mutant Flag-ErbB3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned and inserted into pCMV5-FLAG vector (Agilent Technology). The mouse SVZ cDNA was prepared as described in the ‘qPCR analysis of migrating neurons’ section ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rat monoclonal to flag tag (Agilent Cat# 200474, RRID:AB_10597743). The monoclonal to Xenopus laevis Sox3 (DSHB Cat# DA5H6 ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-Trabid mutants generated by site-directed mutagenesis (QuikChange, Agilent), pEGFP-C1-APC (Rosin-Arbesfeld et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections of human tumors were stained with mouse anti-human CD68 (Dako) and goat anti-human TSP-4 (AF2390 ...