Labshake search
Citations for Agilent :
1 - 50 of 5401 citations for Rat Proto oncogene Mas MAS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Ki67 (rat, DAKO M7249), Fgfr2 (rabbit ...
-
bioRxiv - Pathology 2021Quote: ... rat anti-Ki67 (Dako), mouse anti-γ2pf (Funakoshi) ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-FLAG (Agilent), mouse anti-GFP (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... HRP-conjugated secondary antibodies used for detection were diluted 1:5000 (HRP-mouse anti rat, Cell Signaling Technology, Danvers, MA, Cat# CS7077S; HRP-mouse anti mouse, Dako, Agilent, Santa Clara ...
-
bioRxiv - Cancer Biology 2020Quote: ... HRP-conjugated secondary antibodies used for detection were diluted 1:5000 (HRP-mouse anti rat, Cell Signaling Technology, Danvers, MA, Cat# CS7077S; HRP-mouse anti mouse, Dako, Agilent ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit and Rat respectively (Agilent) for 30 min at RT (anti-SARS-CoV ...
-
bioRxiv - Physiology 2021Quote: ... Plasma insulin was determined with ELISA (Dako Denmark) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... Rabbit anti-Rat HRP (Dako #P0450) and Rabbit anti-Mouse HRP(Dako #P0161).
-
bioRxiv - Microbiology 2021Quote: ... polyclonal goat anti-rat IgG (Dako) and polyclonal goat anti-mouse IgG (Sigma) ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... rat α-DYKDDDDK (#200474-21, Agilent) for FLAG signals ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-rat (rabbit, Dako, 1:2000). Image acquisition and result quantification were conducted using Alliance Q9 Advanced Chemiluminescence Imager (UviTech).
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-rat (1/1000, Dako), goat anti-rabbit (1/200 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Ki67 (Rat, 1:500, Dako, M7249) cleaved Caspase3 (Rabbit ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-rat and anti-rabbit antibodies (Dako).
-
bioRxiv - Neuroscience 2023Quote: ... Rat-anti-Ki67 (DakoCytomation, M7249; 1:200); Rabbit-anti-PH3 (Ser10 ...
-
bioRxiv - Pathology 2023Quote: ... rat and rabbit were obtained from DAKO. The secondary antibodies used for immunofluorescence ...
-
bioRxiv - Cell Biology 2024Quote: ... FLAG (mouse; Sigma-Aldrich or rat; Agilent), HA (rat ...
-
bioRxiv - Cancer Biology 2022Quote: ... For secondary antibody staining, either ImmPRESS kits (anti-goat, MP-7405; anti-rat, MP-7444) or Envision+ Reagents (Dako: rabbit, K4002) were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... the biotinylated rabbit anti-rat secondary antibody (DAKO) was applied ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit-anti-mouse/rat-GFAP (1:3000, Dako), and Mouse-anti-mouse/rat-NeuN (1;200 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Immunology 2023Quote: ... The plate was then measured using a BioTek ELX808 ELISA reader (Agilent) at 450nm and 620-650nm ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat and rabbit nonimmune IgG (Dako or ThermoFisher Scientific) at the corresponding antibody concentration to verify absence of unspecific antibody binding ...
-
bioRxiv - Immunology 2019Quote: ... Immunoreactions were detected using biotinylated donkey anti-rat (Dako) and goat-anti-rabbit (Vector Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... then 1:1500 goat anti-rat IgG-HRP (Dako); anti-histone H4 (Abcam) ...
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Microbiology 2023Quote: ... A rat anti-FLAG mAb was purchased from Agilent Technologies (Santa Clara ...
-
bioRxiv - Biochemistry 2020Quote: ... Q63R and L75G MA mutant constructs were generated using a QuickChange XL site-directed mutagenesis kit (Stratagene). Forward and reverse primers (Integrated DNA Technologies ...
-
bioRxiv - Physiology 2019Quote: ... Secondary antibody (horseradish peroxidase coupled rabbit anti-rat IgG, Dako) was diluted 1:2500 in 1% blocking solution and incubated for 1 h at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-rabbit and anti-rat HRP-conjugated secondary antibodies (Dako). ECL detection was carried out using the Immobilon Crescendo HRP substrate (Millpore ...
-
bioRxiv - Pathology 2023Quote: ... incubated with HRP-conjugated rabbit anti-rat IgG (P0450, Dako) (1:1000 in 1% BSA in TBST) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The rat monoclonal to flag tag (Agilent Cat# 200474, RRID:AB_10597743). The monoclonal to Xenopus laevis Sox3 (DSHB Cat# DA5H6 ...
-
bioRxiv - Epidemiology 2019Quote: ... OGTT plasma insulin concentrations were measured by ELISA (Dako UK Ltd., Ely, Cambs, U.K.). Intra-assay imprecision (CV ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by HRP-conjugated rabbit anti-rat (1:5000, P0450, Dako). For detection of Btn2-HA ...
-
bioRxiv - Physiology 2021Quote: ... Anti-mouse and anti-rat IgG-FITC antibodies were from Dako and the GAPDH antibody from Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... The 1x MAS buffer (Agilent) with 10 mM succinate was used ...
-
bioRxiv - Microbiology 2023Quote: ... α-FLAG MAb (rat) (M2) was purchased from Agilent (Santa Clara, CA). α-HA MAb (mouse) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sections were incubated with rat anti-mouse Ki67 (1:50, DAKO #M7249) for 60 minutes ...
-
bioRxiv - Immunology 2024Quote: ... for 1.5h at RT and HRP-conjugated rabbit anti-rat (Agilent, P0450) for 1h at RT ...
-
bioRxiv - Neuroscience 2023Quote: Primary rat neurons or human i3Neurons were plated on Seahorse XFp plates (Agilent) at a density of 40,000 cells/well ...
-
bioRxiv - Cell Biology 2021Quote: ... or ESI LC-MS (Agilent, MA).
-
bioRxiv - Cancer Biology 2021Quote: ... The sections were then stained with polyclonal rabbit anti-rat IgG (1:200, Dako), or EnVision rabbit (Dako ...
-
bioRxiv - Microbiology 2021Quote: ... A rat anti-FLAG monoclonal antibody (200474) was purchased from Agilent (Santa Clara, CA). MS2 capsid proteins were detected with a polyclonal rabbit antibody (ABE76-I ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary α-DAT was detected by using secondary rabbit anti-rat (1;1,000; Dako, P0450). Upon visualization by using the ECL Advanced Chemiluminescence kit (GE Healthcare Life Sciences® ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ki-67 was detected using a rat an,-Ki67 monoclonal an,body (Dako M7249) at a 1:25 dilu,on followed by bio,nylated goat an,-rat an,body secondary (Jackson ImmunoResearch 112-065-167 ...
-
bioRxiv - Bioengineering 2020Quote: ... ENVs were collected 3 days after electroporation and analyzed for miR-101-3p content by RT-PCR using the qScript microRNA cDNA Synthesis Kit (Quanta Biosciences, Beverly, MA) and SYBR Mastermix (Quanta Biosciences) on a Stratagene Mx 3000 P (Stratagene, San Diego, CA). The primer for miR-101-3p was (TACAGTACTGTGATAACTGAA) ...
-
bioRxiv - Pathology 2019Quote: ... FLAG-tag was inserted between the CAAX motif (CVIQ) and stop codon in the full-length construct (Cat No: 200523, QuickChange II Site-Directed Mutagenesis kit, Agilent Technologies, Lexington, MA). For removal of the INF2 cleavage site ...
-
bioRxiv - Microbiology 2023Quote: ... and 2100 Bioanalyzer (Agilent Technologies, Lexington, MA), respectively ...