Labshake search
Citations for Agilent :
101 - 150 of 7659 citations for Rat Oligodendrocyte transcription factor 1 OLIG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Antibodies used for paraffin immunostaining were: rat anti-mouse Ki67 monoclonal antibody (MIB-5, Dako) and rabbit anti-mouse Yap1 antibody (D8H1X ...
-
bioRxiv - Cell Biology 2020Quote: Quantitative reverse transcription PCR (qRT-PCR) analysis was carried out on an MX300-P (Agilent technologies) using gene specific primers (QuantiTect® ...
-
bioRxiv - Cell Biology 2023Quote: Non-codon optimised sequences were amplified from a human cDNA library (MegaMan human transcription library, Agilent). Mis18α ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was prepared using miRNA 1-st strand cDNA synthesis kit (Agilent). Mature miRNA sequence and Universal reverse primer (Agilent ...
-
bioRxiv - Genetics 2021Quote: ... with the HS NGS Fragment Kit (1-6000 bp, DNF-474, Agilent, formerly Advanced Analytical ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the NGS Fragment High Sensitivity Analysis Kit (1-6,000 bp; Agilent). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the NGS Fragment High Sensitivity Analysis Kit (1-6,000 bp; Agilent). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the NGS Fragment High Sensitivity Analysis Kit (1-6,000 bp; Agilent). Libraries were subjected to cluster generation and base calling for 150 cycles paired end on Illumina NextSeq 500 platform.
-
bioRxiv - Molecular Biology 2023Quote: ... using the NGS Fragment High Sensitivity Analysis Kit (1-6,000 bp; Agilent). Libraries were subjected to cluster generation and base calling for 100 cycles paired end on Illumina NextSeq 2000 platform.
-
bioRxiv - Systems Biology 2020Quote: ... mouse and naked mole rat cells were plated onto a Seahorse XF96 Cell Culture Microplate (Agilent) at a cell density of 105,000 and 80,150 cells per well respectively to allow the cells to be 100% confluent ...
-
bioRxiv - Genomics 2019Quote: ... and hybridized onto SurePrint G3 Rat GE 8 x 60K Microarrays v2 (AMADID 074036; Agilent Technologies) for 16-20 h at 65°C in an Agilent oven with rotisserie ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were washed between all experimental step with PBS plus 0.1% Tween 20 (405 TS ELISA Plate Washer, Agilent Technologies). Blocking (1% Omniblok ...
-
bioRxiv - Immunology 2023Quote: Antibodies against SARS-CoV-2 were measured using a high-throughput direct chemiluminescent ELISA performed on MicroLab STAR robotic liquid handlers (Hamilton) fitted with a 405TS/LS LHC2 plate washer (Biotek/Agilent) (full methods described previously)27 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10 mM glucose (for the Cell Mito Stress Test Kit) or 1 mM glutamine (for the Glycolysis Stress Test Kit) was used as the assay medium (103681-100; Agilent Technologies). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the NGS Fragment High Sensitivity Analysis Kit (1-6,000 bp; Agilent Technologies). The libraries were sequenced on Illumina instrument (NEXTSeq500).
-
bioRxiv - Cell Biology 2019Quote: ... KLF4 and C-MYC open reading frames under the control of the human elongation factor-1α (EF-1α) promoter in the presence of 1.2% GeneJammer (a polyamine-based transfection reagent; Stratagene, La Jolla, CA, USA). Cells were maintained in mTeSR™1 (STEMCELL Technologies ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... mouse (Fig. S8b) and naked mole-rat (Fig. 2a-c) marrowSeahorse XF96 Cell Culture Microplates (Agilent Technologies) between 50-250*103 cells per 200µl of the following culture media ...
-
bioRxiv - Systems Biology 2020Quote: ... After double XP beads purifications (with beads added in a ratio 1:1) libraries were quantified on a Fragment Analyzer run with a NGS Assay Kit (Agilent) and loaded on a HiSeq 3000 flowcell with 50 cycles single end sequencing by pooling the samples based on molarity aiming for 30 mio ...
-
bioRxiv - Neuroscience 2023Quote: ... pooled libraries were additionally purified with AMPure beads (ratio 1:1) to remove contaminating primer dimers and quantified using Qubit and the Bioanalyzer High-Sensitivity DNA kit (Agilent). 50-bp paired-end deep sequencing was carried out on HiSeq 4000 (Illumina).
-
bioRxiv - Immunology 2023Quote: ... RNA was subjected to reverse transcription primed by CMVR-SOSIP-rev (cacagcagatct tcatcagcggggctttttctg) using AccuScript Reverse Transcriptase (Agilent) to generate cDNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... and programmed cell death ligand 1 (PD-L1; clone 22C3, pharmDx kit, Agilent, USA) were used ...
-
bioRxiv - Immunology 2023Quote: ... After incubation with the rIgE’s the wells were washed four times with ELISA wash buffer and incubated with 100 μL of 1,3 μg/mL rabbit anti-human IgE-conjugated HRP (DAKO, cat no: P0295) for 1 hour at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... using a high-sensitivity NGS Fragment Kit (1-6000bp) (Agilent, catalog no. DNF-474-0500). Sequencing libraries were loaded on an Illumina NovaSeq6000 with PE 2 × 50 paired-end kits by using the following read length ...
-
bioRxiv - Immunology 2021Quote: ... Sections were incubated with primary antibodies for CD117 (A4502-CD117,c-kit, DAKO, 1:500), followed by washing and incubation with post primary (Novolink ...
-
bioRxiv - Genomics 2021Quote: ... using a DNF-474 High Sensitivity NGS Fragment Kit 1-6000bp (Agilent, DNF-474-0500). We generally observe approximately 5-10 ng/ul ...
-
bioRxiv - Genetics 2020Quote: ... cDNA library size was checked using Fragment Analyzer HS NGS Fragment Kit (1-6000bp) (Agilent formerly Advanced Analytical ...
-
bioRxiv - Genetics 2023Quote: ... using a high-sensitivity NGS Fragment Kit (1-6000bp) (Agilent, catalog no. DNF-474-0500). Sequencing libraries were loaded on an Illumina NovaSeq6000 with PE 2 x 50 paired-end kits by using the following read length ...
-
bioRxiv - Cell Biology 2022Quote: ... The secondary antibodies used were goat anti-rabbit and rat anti-rabbit IgG-HRP (Dako, Santa Clara, CA, USA). Proteins were detected by chemiluminescence using the Clarity™ Western ECL Substrate coupled to a ChemiDoc XRS+(Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... and generic real-time reverse-transcription PCR (RT-qPCR) as previously published (29) in AriaMx real-time cycler (Agilent, Germany). Standard curves generated by serial dilutions of B_NS217 (10 to 100000 pfu ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting cDNA was amplified with an overnight in vitro transcription reaction and the quality of the RNA was evaluated using TapeStation (Agilent). From this amplified RNA ...
-
bioRxiv - Plant Biology 2024Quote: ... This cDNA was used as template for cRNA generation using in vitro transcription and incorporation of the dye Cy3 CTP(Agilent). Cleaning of cRNA was done using Qiagen RNeasy columns (Qiagen ...
-
bioRxiv - Systems Biology 2022Quote: ... The quality of the library was measured using Fragment Analyzer NGS Fragment Kit (1-6000bp) (Agilent). Pooled libraries were then sequenced using NextSeq 500/550 (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: ... CCH-1 and CCH-10 EGFR sequences using Quikchange Lightning site-directed mutagenesis kit (Agilent Technologies), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and quality was assessed with the HS NGS Fragment Kit (1–6,000bp; DNF-474, Agilent Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... After washing with TBST three times, membranes were exposed to appropriate secondary antibodies (anti-rabbit, anti-mouse, and anti-rat) coupled to HRP (Dako) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... slides were washed and incubated with the corresponding secondary antibodies when needed (rabbit anti mouse, Abcam; rabbit anti rat, Vector; Goat anti-rabbit, Dako) and visualization systems (Bond Polymer Refine Detection ...
-
bioRxiv - Cancer Biology 2023Quote: Dual indexed whole exome capture libraries were prepared from mouse and naked mole-rat skin biopsies and matched livers using SureSelect XT HS and XT Low Input Enzymatic Fragmentation protocol (Agilent). For mouse whole exome sequencing (WES ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plates were then incubated at 37°C for 48 hours then analyzed by flow cytometry and ELISA or monitored for target cell death using xCelligence eSight (Agilent Technologies, Inc., Santa Clara, CA).
-
bioRxiv - Physiology 2022Quote: ... the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and their integrity was assessed via 1% agarose gel electrophoresis or Bioanalyzer RNA 6000 Nano kit (Agilent). Library quantification ...
-
bioRxiv - Cancer Biology 2023Quote: ... or a High Sensitivity NGS Fragment Analysis Kit (1 bp - 6,000 bp) on a Fragment Analyzer (Agilent). Libraries were quantified by Qubit dsDNA HS Assay (Life Technologies) ...
-
bioRxiv - Genetics 2023Quote: ... 1 μg RNA was used to synthesise cDNA using the Multi-temp cDNA Synthesis kit (Agilent, #200436). The final reaction volume was made up to 1ml with nuclease free water and used for RT-qPCR analysis.
-
bioRxiv - Physiology 2022Quote: ... Immunologic), the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Bioengineering 2023Quote: ... bEnd.3 cells were seeded at a density of 6×103 cells/well in rat tail collagen-coated (150 µg/mL) 96-well plates (E-plate 96; Agilent, cat# 300600910) and confluent monolayers were treated as described above for human ECs ...
-
bioRxiv - Bioengineering 2023Quote: ... rat ECs were seeded at a density of 6×103 cells/well in 96-well plates (E-plate 96; Agilent, cat# 300600910) coated with collagen IV (100 μg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... and hypoxanthine guanine phosphoribosyl transferase (HPRT) were assessed by quantitative reverse transcription polymerase chain reaction (RT-qPCR, Mx3005P QPCR System (Agilent, Santa Clara, CA). After 24 or 48 h of incubation in normoxia ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-EGFP was made using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs ...