Labshake search
Citations for Agilent :
501 - 550 of 7579 citations for Rat Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: A C18 (Agilent ZORBAX 300SB, 5 μm, 300 Å) pre-column (360 μm o.d ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with a Bio SEC-5 2000 Å guard (Agilent). The mobile phase was PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Systems Biology 2022Quote: ... equipped with a VF-5 ms column (Agilent Technologies) of 30 m length ...
-
bioRxiv - Immunology 2023Quote: Images were acquired with a Biotek Cytation 5 (Agilent) and images were analyzed with Biotek Gen5 software ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5’ and mounted with fluorescent mounting medium (Dako). The Lmx1a antibody detection capability was improved using the Tyramide Signal Amplification kit (TSA ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 μl SYBR green (Agilent Technologies, CA, United States), and 2 μl nuclease-free water ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm particle size (Zorbax XDB C8, Agilent Technologies). The analytes were eluted using a gradient starting with 50% mobile phase B that increased to 98% within 2.3 min and was held for 1.0 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse phase-S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Biophysics 2021Quote: ... All mice were anaesthetized (1.5-1.8% isoflurane in 1.5 l/min air with balance in oxygen) and scanned on a 9.4 T Agilent system (Agilent Technologies, Santa Clara, CA, USA) using a 33-mm-diameter transmit/receive coil (Rapid Biomedical GmbH ...
-
bioRxiv - Neuroscience 2020Quote: Specimens were formalin-fixed at time of collection and then agarose-gel-embedded (Fig. S2B) before being examined using a 4.7-T Agilent MR scanner (Agilent Technologies, Santa Clara, CA) with a home-made circular surface coil (1.5-cm diameter ...
-
bioRxiv - Biophysics 2021Quote: ... All mice were anaesthetized (1.5-1.8% isoflurane in 1.5 l/min oxygen with balance in air) and scanned on a 9.4 T Agilent system (Agilent Technologies, Santa Clara, CA, USA) using a 33-mm-diameter transmit/receive coil (Rapid Biomedical GmbH ...
-
bioRxiv - Physiology 2022Quote: ... Immunologic), the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Immunology 2020Quote: ... 1:4000, rat anti-mouse IgG3-biotin (Becton, Dickinson, Franklin Lakes, New Jersey) 1:2000 followed by streptavidin-HRP (Dako, Glostrup, Denmark) 1:1000 incubated at 37°C for 1h.
-
bioRxiv - Cell Biology 2020Quote: ... 2 μM fluoro-carbonyl cyanide phenylhydrazone (FCCP) and 0.5 μM rotenone + 0.5 μM antimycin from the Seahorse XF Cell Mito Stress Test Kit (Agilent Technologies). Data was analyzed by the Seahorse XF Cell Mito Stress Test Report Generator ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR products of positive clones were then cloned into competent cells using the StrataClone PCR Cloning Kit (Agilent) according to the manufacturer’s protocol ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... Subsequently we strictly adhered to the Seahorse XF Cell Mito Stress Test Kit protocol (Agilent Technologies Cat# 103015-100). Cells were counted before and after the assay using a Celigo S Image cytometer (Nexcelom Biosciences ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from cryopreserved tumour samples or cultured cells using the Total RNA Isolation Micro kit (Agilent) and cDNA then synthesized using SuperScript VILO cDNA synthesis kit (Life Technologies) ...
-
bioRxiv - Systems Biology 2020Quote: ... and centrifuged again to remove the supernatant.RNA was then extracted from the isolated disc cells using Absolutely RNA Nanoprep Kit (Stratagene), following manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... After 2h of AIM2 activation cells were processed per manufacturer’s directions and analyzed using the Agilent Seahorse Mito Stress Test kit (Agilent). For over-night stimulation with LPS cells were treated 2h after plating with 10 ng/mL LPS and incubated overnight at 37°C.
-
bioRxiv - Neuroscience 2022Quote: ... 1 μM fluoro-carbonyl cyanide phenylhydrazone (FCCP) and 0.5μM/0.5μM rotenone/antimycin A (all XFp Cell Mito Stress Test Kit, Agilent Technologies, 103010-100) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting fragments were cloned into the StrataClone TA-cloning vector and transformed into StrataClone SoloPack competent cells according to the manufacturer’s protocol (StrataClone PCR Cloning Kit, Agilent), resulting in pFF-162 (SpoY) ...
-
bioRxiv - Cell Biology 2022Quote: ... To investigate mitochondrial respiration and energetic phenotypes a Seahorse XFp Cell Mito Stress Test kit (103010-100, Agilent Technologies) was used ...
-
bioRxiv - Cancer Biology 2023Quote: The mitochondrial function of MAFs was measured with a Seahorse XF Cell Mito Stress Test Kit (103015-100, Agilent) using a Seahorse XF96 Extracellular Flux Analyzer ...
-
bioRxiv - Cell Biology 2024Quote: ... To investigate mitochondrial respiration and energetic phenotypes a Seahorse XFp Cell Mito Stress Test kit (103010-100, Agilent Technologies) was used.
-
bioRxiv - Cell Biology 2024Quote: Oxygen Consumption Rates (OCR) were measured using the Seahorse XF Cell Mito Stress Test Kit (Agilent, Cat. 103708-100) with a Seahorse XFe96 analyzer (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein was also detected as it eluted from the column with a differential refractometer (Optilab T-rEX, Wyatt Technology) and a UV detector at 280 nm (Agilent 1260 UV, Agilent Technology). Molar masses of peaks in the elution profile were calculated from the light scattering and protein concentration ...
-
bioRxiv - Neuroscience 2020Quote: ... MR scans were performed using a quadrature surface RF coil and a 9.4 T/31 cm magnet (Magnex Scientific, Abingdon, UK) interfaced to an Agilent console (Agilent, Inc., Palo Alto, CA, USA). A cerebellar volume-of-interest (VOI ...
-
bioRxiv - Immunology 2023Quote: ... blots were washed before adding the secondary antibodies (Polyclonal Swine Anti-Rabbit Immunoglobulins/HRP (Dako p0399; 1:5000 in 1% BSA and TBS-T) and Polyclonal Goat Anti-Mouse Immunoglobulins/HRP (Dako p0447 ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Neuroscience 2022Quote: ... In all rats, antibodies staining for neurons (Mouse anti-NeuN, MAB377, MiliporeSigma) and astrocytes (Rabbit anti-GFAP, Z0334, Dako/Agilent, Santa Clara, CA) were used ...
-
bioRxiv - Neuroscience 2022Quote: ... In all rats, antibodies staining for neurons (Mouse anti-NeuN, MAB377, MiliporeSigma) and astrocytes (Rabbit anti-GFAP, Z0334, Dako/Agilent, Santa Clara, CA) were used ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cell Biology 2022Quote: ... of hPASMC were measured using Seahorse XF96 metabolic analyzer and Seahorse XF Cell Mito Stress Test kit (103015-100, Seahorse XF Technology, Agilent), following manufacturer’s recommendations ...