Labshake search
Citations for Agilent :
251 - 300 of 5577 citations for Rat N acylethanolamine hydrolyzing acid amidase NAAA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: PHDsuper-FN3VRN5 from Zm for XL-MS analysis was inserted into pEC-LIC-His-3C containing a hexa-histidine tag and 3C protease cleavage site at the N terminus and was expressed in BL21 CodonPlus (DE3)-RIL cells (Agilent) in LB medium ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Plant Biology 2023Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation with 50 µl/well of HRP-conjugated rabbit anti-mouse total IgG (1:1,000 in ELISA dilution buffer; P0260, Dako Agilent, Santa Clara, CA, USA), goat-anti-mouse IgG1 (1:8,000 in ELISA dilution buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and incubated with biotinylated rabbit anti-rat IgG for 1h (1:200, DAKO Cytomation A/S, Denmark). Following avidin-biotin-peroxidase complex (Vector laboratories ...
-
bioRxiv - Cell Biology 2022Quote: ... After washing with TBST three times, membranes were exposed to appropriate secondary antibodies (anti-rabbit, anti-mouse, and anti-rat) coupled to HRP (Dako) for 1 hour at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... slides were washed and incubated with the corresponding secondary antibodies when needed (rabbit anti mouse, Abcam; rabbit anti rat, Vector; Goat anti-rabbit, Dako) and visualization systems (Bond Polymer Refine Detection ...
-
bioRxiv - Neuroscience 2023Quote: Double immunofluorescence for activated pro- and anti-inflammatory microglial cells was performed as above with rat anti-CD86 (M1; 1:1600 dilution, Dako) and goat anti-CD206 (M2 ...
-
bioRxiv - Cancer Biology 2023Quote: Dual indexed whole exome capture libraries were prepared from mouse and naked mole-rat skin biopsies and matched livers using SureSelect XT HS and XT Low Input Enzymatic Fragmentation protocol (Agilent). For mouse whole exome sequencing (WES ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype ...
-
bioRxiv - Immunology 2024Quote: ... In Nr4a1-/- and Nr4a1+/+ mouse thrombus sections neutrophils were visualized by anti-Ly6G (clone: 1A8; isotype: rat IgG2a) and MPO (rabbit polyclonal, #GA51161-2, DAKO; isotype: rabbit immunoglobulin fraction, DAKO). Alexa labeled secondary antibodies (Invitrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mutations in amino acid position 339 of KLF1 were introduced by site directed mutagenesis (Agilent Technologies), primers are available upon request ...
-
bioRxiv - Biochemistry 2019Quote: ... using a linear gradient from 5 to 55% acetonitrile over 6.5 min with 0.1% formic acid as the aqueous mobile phase after an initial hold at 95% 0.1% formic acid for 0.5 min (0.6 mL/min) using a 1290 Infinity II UHPLC (G7120AR, Agilent). Peptides were identified using LC-HRMS as described previously.23
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1% [v/v] formic acid in water and injected onto an Agilent1200 (Agilent, Santa Clara, CA, USA) nano-flow LC system that was in-line coupled to the nano-electrospray source of a LTQ-Orbitrap Discovery hybrid mass spectrometer (Thermo Scientific ...
-
bioRxiv - Zoology 2021Quote: ... The amino acid composition of the hydrolyzed samples was determined using High Performance liquid Chromatography (HPLC-Agilent 1260 Infinity series ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular fatty acids were extracted and determined from dried cells by using GC (model 7890A, Agilent, USA) according to the protocol of the Sherlock Microbial Identification System (61) ...
-
bioRxiv - Immunology 2024Quote: ... Amino acid substitutions in G12V-TCR were generated by quick-change site-directed PCR mutagenesis (Agilent, USA). TCRs were transiently transfected into 293T-mCD3-GFP cells and stained separately with PE anti-mTCRβ mAb (Biolegend ...
-
bioRxiv - Physiology 2024Quote: ... Total bile acids assay (Diazyme Laboratories, CA, USA) and BioTek Epoch Microplate Spectrophotometer (Agilent Technologies, CA, USA) were used to measure total BA concentrations to determine the volume of cholestyramine-untreated extract needed to add for a final concentration of ∼300 μM BAs in the ileal explant culture media ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plates were then incubated at 37°C for 48 hours then analyzed by flow cytometry and ELISA or monitored for target cell death using xCelligence eSight (Agilent Technologies, Inc., Santa Clara, CA).
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Physiology 2022Quote: ... the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... Blots were rinsed three consecutive times with Tris buffer (5min) and 1:10000 diluted donkey- or goat-anti-rat-HRP (Agilent Technologies) or 1:25000 diluted goat-anti-mouse-HRP (BioRad ...
-
bioRxiv - Microbiology 2021Quote: ... Each lipid spot was extracted for quantification of fatty acids by gas chromatography-mass spectrometry (Agilent 5977A-7890B) after methanolysis ...
-
bioRxiv - Microbiology 2019Quote: ... Each lipid spot was extracted for quantification of fatty acids by gas chromatography-mass spectrometry (Agilent 5977A-7890B) after methanol lysis ...
-
bioRxiv - Cell Biology 2019Quote: VARIAN PL-Microspheres SuperCarbonyl White poly(styrene-co-methancrylic acid) 20 μm in diameter (Batch CD185, Agilent Technologies) were coated as described 13 ...
-
bioRxiv - Neuroscience 2019Quote: The bile acid level in plasma samples was measured using HPLC-MS/MS (Agilent model LC1260 QQQ 6495). Chromatographic separation was performed in an ACQUITY UPLC HSS T3 column (2.1 mm × 100 mm ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cell Biology 2020Quote: ... ShhHA and C25SShhHA (HA inserted between amino acids 197 and 198) were generated by site-directed mutagenesis (Stratagene). Unlipidated C25SShhN cDNA and non-palmitoylated C25AShh cDNA (amino acids 1-438 ...
-
bioRxiv - Immunology 2021Quote: Short chain fatty acid concentrations were determined using gas chromatography (3800 Varian GC, Agilent Technologies, Santa Clara, CA). For each sample ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.3 μL of acetic acid was added to the sample before desalting with a C18 tip (Agilent A57203). The C18 tip was washed three times with 200 μL of methanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amino acid substitutions in the C-terminal (126-250) truncation were created via QuikChange site-directed mutagenesis (Agilent). pDEST-mCherry-LacR-RIF1 (1-567 ...
-
bioRxiv - Plant Biology 2023Quote: ... The chromatographic separations of free amino acids were carried out using a HILIC-Z column (2.1×150 mm, particle size 2.7 µm, Agilent) employing a linear binary gradient of (A ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides with PCa tissue samples (n=144) were incubated at 60°C for 2 hours followed by target retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...