Labshake search
Citations for Agilent :
1 - 50 of 2794 citations for RGPD1 2 3 4 5 8 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Cancer Biology 2021Quote: HLA-restriction of antigen recognition was tested in anti-IFN-γ ELISpot using autologous DCs loaded with the relevant peptide or without peptide (negative control) and blocking antibodies against HLA class I and II (both Dako). DCs were incubated with peptides overnight and the next day anti-HLA mABs were added to ELISpot plates for 1 hour prior to the addition of expanded cells at a ratio of 1 DC to 50 expanded cells ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Cell Biology 2024Quote: ... Dako REAL Peroxidase-blocking reagent (Agilent S202386-2), bluing reagent (Leica ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Genomics 2019Quote: ... Blocking was performed by 1h incubation in humid chamber with 3% of normal donkey serum (Vendor) in blocking solution (DAKO). Slides were incubated in humid chamber with primary antibodies overnight at 4°C and washed in PBS 0.2% Triton-X100 ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). For ER ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). For CK5/6 ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). A monoclonal rabbit Ki67 antibody (M7240 ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by blocking with Dako Protein Block (Agilent X090930-2). Cutaneous melanocytes were labeled with anti-gp100 primary antibody (1:100 ...
-
bioRxiv - Immunology 2020Quote: ... consistently identified GFAP peptides while minimizing nonspecific off-target peptide identification (Agilent Z033429-2, 1:200 dilution). Each peptide was required to have a minimum of 1 RPK as well as a FC > 10 ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Neuroscience 2020Quote: ... a 3-minute incubation in Envision FLEX Peroxidase-blocking Reagent (GV823, Agilent DAKO) was performed ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated in serum free blocking solution (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... the slides were incubated in DAKO blocking peroxide (S200389-2, DAKO) for 30 mins to eliminate non-specific staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... the slides were incubated in DAKO blocking peroxide (S200389-2, DAKO) for 30 mins to eliminate non-specific staining ...
-
bioRxiv - Plant Biology 2021Quote: ... Peptides were first loaded onto a C18 trap column (5 µm, 5 × 0.3 mm, Agilent Technologies) and then eluted into a C18 analytical column (75 μm × 150 mm ...
-
bioRxiv - Microbiology 2023Quote: ... a peroxidase blocking step of 5 min at room temperature (S2023; Agilent) followed by saturation of nonspecific binding sites with normal goat serum (X0907 ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Pathology 2021Quote: ... Blocking was performed in 5% normal goat serum (GS)/PBS (Dako, Glostrup, Denmark) for 60 min ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Cancer Biology 2021Quote: ... tumor sections were incubated with Envision Flex Peroxidase-Blocking Reagent (Dako, S202386-2) for at least 5 minutes ...
-
bioRxiv - Physiology 2020Quote: ... Non-specific antibody association was blocked with 2 drops of blocking solution (DAKO). Primary antibody was diluted in dilution buffer (DAKO) ...
-
bioRxiv - Pathology 2023Quote: ... endogenous peroxidases were quenched with DAKO REAL Peroxidase-Blocking Solution (S202386-2, Agilent) for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Bioengineering 2021Quote: ... samples were subjected to a treatment with 0.3% Sudan black solution for 10 min prior to blocking for 2 h (Dako Blocking Solution X0909; Agilent Technologies, Santa Clara, CA). Immunofluorescence staining was then performed using antibodies to detect CD31 (dilution 1:250 ...
-
bioRxiv - Cell Biology 2019Quote: ... The sections were stained as follows: 1) blocking endogenous peroxidases for 5 min (DAKO Real Peroxidase Blocking solution ...
-
bioRxiv - Microbiology 2019Quote: ... 1% acetonitrile/0.5% formic acid was used as eluent for 5 minutes to trap and desalt the peptides on the enrichment column (Zorbax SB C18, 0.3 × 5 mm, Agilent). An acetonitrile/0.1% formic acid gradient from 5% to 40% acetonitrile was then used within 120 minutes to separate the peptides on a Zorbax 300 SB C18 ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Immunology 2022Quote: ... and the resulting peptides were captured and desalted by C-8 trap column (2.1 × 20 mm, Zorbax Eclipse XDB-C8 trap (Agilent) followed by loading on to C-18 column (2.1 × 50 mm in size ...
-
bioRxiv - Biochemistry 2023Quote: Probe-phosphonate–labeled peptides were enriched using Fe(III)-NTA 5 μl (Agilent Technologies) in an automated fashion by the AssayMAP Bravo Platform (Agilent Technologies) ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each cycle included a 5 min blocking step with serum free Protein Block (Agilent, #X0909), primary antibody incubation for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Blocking was with serum-free protein blocking solution (Agilent) for 1 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... After blocking with serum free protein blocking solution (Dako), slides were incubated for primary antibodies for 1h at RT ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Neuroscience 2022Quote: ... Endogenous peroxidase was blocked using a ready-to-use peroxidase-blocking solution (S202386-2, Dako). The primary antibody was diluted in antibody diluent (S080983-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 200 μL of blocking solution containing 50% serum-free protein block (X090930-2, Dako) and 50% normal horse serum (2.5% blocking solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were blocked with 5 μg/ml human immunoglobulins solved in blocking serum-free medium (Dako) for 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... followed by blocking using DAKO blocking buffer (DAKO, Hamburg, Germany) for 60 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... onto a peptide trap (Zorbax 300 SB-C18, 0.3 i.d. × 5 mm, 5 µm, 300 Å; Agilent Technologies, Santa Clara, CA, USA) for concentration and desalting with a pump running in isocratic mode with 0.1% formic acid in water ...