Labshake search
Citations for Agilent :
401 - 450 of 1819 citations for Peripheral Blood Mononuclear Cell since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... coli BL21 (DE3)-gold cells (Agilent Technologies, USA), as described 52 ...
-
bioRxiv - Biochemistry 2023Quote: ... E.coli XL-10 cells were provided by STRATAGENE EUROPE.
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 DE3 RIL (codon plus) cells (Stratagene). All cDNA plasmids ...
-
bioRxiv - Biochemistry 2023Quote: ... prior to transformation into DH5ɑ competent cells (Agilent). Successful mutation of isolated clones was verified by Sanger sequencing and clones were retransformed into BL21-CodonPlus (DE3)-RP competent cells (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: The Seahorse XF Cell Mito Stress Test (Agilent) was performed as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Cell proliferation was measured on xCELLigence® (Agilent) E-Plate VIEW (96 wells ...
-
bioRxiv - Cell Biology 2023Quote: ... chemically competent BL21-CodonPlus (De3) cells (Agilent Technologies) were transformed with the respective pET-28 vector via 42°C heat shock and plated overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21-CodonPlus(DE3)-RIL cells (Agilent Technologies) were used ...
-
bioRxiv - Biophysics 2023Quote: ... was transformed into Escherichia coli BL21 cells (Agilent). Cells were grown and protein expression was induced by the addition of 0.2 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Bioengineering 2023Quote: ... coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with 100 µg/mL of ampicillin (amp100 ...
-
bioRxiv - Bioengineering 2023Quote: ... Coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with amp100 and 1% glucose at 37 °C and 250 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... coli BL21-Gold (DE3) chemically competent cells (Agilent), which were then grown overnight in LB with amp100 and 1% glucose at 37 °C and 250 rpm ...
-
bioRxiv - Cancer Biology 2023Quote: ... Seahorse XF96 Cell Culture Microplates (101085; Agilent Technologies) were treated with Cell-Tak Cell and Tissue Adhesive (354240 ...
-
bioRxiv - Genetics 2023Quote: ... coli Arctic Express (DE3) cells (Agilent Technologies Inc.) transformed with the mouse RNF212B-6xHis expression vector were grown in 2L of LB at 30°C to an OD600 of 0.8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were washed once with Rinse solution (Dako) at room temperature for 10 seconds ...
-
bioRxiv - Cell Biology 2023Quote: ... and transformed into XL10 Gold competent cells (Agilent). Bsp11-407 was amplified using primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgccgtttcttcaggttattcc ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were mounted with fluorescence mounting medium (DAKO). Images were captured by a Zeiss Axio Imager Z1.
-
bioRxiv - Cell Biology 2024Quote: AD293 cells (Cat # 240085, Agilent, Santa Clara, USA) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2024Quote: ... BL21-CodonPlus (DE3)-RIPL competent cells (Agilent, 230280) are transformed with sequence-validated vectors ...
-
bioRxiv - Immunology 2024Quote: ... a Seahorse cell culture 96 well-plate (Agilent) was coated with 50μL/well of 50 μg/mL Gibco Poly-D-lysine (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Unbound antibody was removed with washing buffer and the fraction of cells with surface protein labeled with CD44 antibody was determined using a MoFlo cell sorter (Dako Cytomation).
-
bioRxiv - Cell Biology 2019Quote: We assessed the respiratory capacity of NPKO and control cells using the Cell Mito Stress Test Kit (Agilent Cat. #103010-100) on the Agilent Seahorse XFp instrument ...
-
bioRxiv - Cell Biology 2021Quote: ... MSCs were seeded at a density of 10,000 cells/well in a XF96 cell culture 96-well microplate (Agilent 101085-004) precoated with 10 µg/ml of fibronectin (Sigma F1141) ...
-
bioRxiv - Immunology 2021Quote: ... SC-macrophages or SC-macrophages treated with 10 nM RvD1 as above were seeded (30,000 cells/well) on a Seahorse XF96 cell culture plate (Agilent, #102601-100). The cells were incubated in glucose-free ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa and MDA-MB-231 cells were plated accordingly as low (50% confluency) and high (100% confluency) density cultures in 24 well cell plates (Seahorse bioscience) in DMEM growth medium containing 10% FBS and placed in a 5% CO2 incubator ...
-
bioRxiv - Neuroscience 2020Quote: ... HAP1 (40,000 cells/well) and DU145/Rho0 (30,000 cells/well) were plated on Agilent Seahorse XF96 V3-PS Microplates (Agilent 101085-004) approximately 24 hours before stress tests ...
-
bioRxiv - Cancer Biology 2020Quote: ... we plated A101D and MeWo cells at 30,000 live cells per well in a 96-well plate (Agilent, Santa Clara, CA). Cells were plated in either control or homocysteine media and incubated for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... Single-cell clones were made for each strain by depositing epimastigotes into a 96-well plate at a density of 0.5 cell/well by using a MoFlow cell sorter (Dako-Cytomation, Denmark). One healthy clone that has confirmed to have cycled through all life stages was chosen for sequencing for each strain ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell lines were karyotyped after in-house expansion by Cell Line Genetics using array comparative genomic hybridization (aCGH, Agilent 60K Standard). Limited chromosomal imbalances in non-critical genes were reported ...
-
bioRxiv - Immunology 2023Quote: ... Cells were resuspended at a concentration of 8×106 cells/ml in Seahorse XF Base Medium (Agilent Technologies, Santa Clara, CA) supplemented with 1 mM pyruvate ...
-
bioRxiv - Cell Biology 2022Quote: ... were assessed using the XF96 Extracellular Analyzer as described in manufacturer’s instructions for the XF cell mito stress and the XF cell mito fuel flex test kits (Agilent Technologies, CA).Briefly ...
-
LSD1 inhibition improves efficacy of adoptive T cell therapy by enhancing CD8+ T cell responsivenessbioRxiv - Immunology 2023Quote: Seahorse experiments were performed on sorted CD8+ cells activated in presence or absence of LSDi using XF Cell Mito Stress kit (Seahorse Bioscience). OCR and ECAR were measured with XF96 Extracellular Flux Analyzers (Seahorse Bioscience) ...
-
bioRxiv - Physiology 2024Quote: Fuel preference of CRISPR/Cas9 Pparγ edited cells (γY4KO) and mock-edited cells (C) was measured using Seahorse Mito-Fuel Flex test (Agilent Technologies), in assay medium as above and according to the manufacturer protocol ...
-
bioRxiv - Physiology 2024Quote: ... The function of mitochondria was assessed in isolated acinar cells by measurement of oxygen consumption rate (OCR) employing a Seahorse XF Cell Mito Stress Test system (Agilent, USA). Briefly ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were counted and seeded at 80,000 cells per well in the 96-well Agilent Seahorse XF Cell Mito Stress Test (Agilent 103010-100) assay plate ...
-
bioRxiv - Cell Biology 2022Quote: ... PSC27 was seeded at a density of 5 × 104 cells/ well in the XF24 cell culture microplate (Agilent Technologies, 04721 and Q01321) at a 37[5% CO2 incubator for overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... HAP1 cells and SH-SY5Y cells were seeded at a density of 40,000 cells/well and HEK293 cells were seeded at a density of 20,000 cells/well on Seahorse XF96 V3-PS Microplates (Agilent Technologies, 101085-004) after being trypsinized and counted (Bio-Rad TC20 automated Cell Counter ...
-
bioRxiv - Neuroscience 2024Quote: ... fibroblasts were seeded at 45 × 103 cells per well (5-10 replicates per cell line) in fibroblast growth media in a Seahorse XFe24 Microplate (Agilent, 100777-004) and incubated for 24 hours to allow cells to adhere ...
-
bioRxiv - Cancer Biology 2021Quote: ... and XF Cell Mito Stress Test Kit (Seahorse Bioscience). Cells were seeded at 50,000 cells/well (~80-90% confluent when assayed ...
-
bioRxiv - Biochemistry 2020Quote: ... ctXPD was expressed in ArcticExpress (DE3) RIL cells (Agilent). Ctp62/ctp44 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The XF Cell Mito Stress Test Kit (Agilent, 103015), was used for the assay ...
-
bioRxiv - Cell Biology 2022Quote: BL21-CodonPlus (DE3)-RIL competent cells (Agilent Technologies 230245) were transformed with Cas9 plasmid (Addgene #67881) ...
-
bioRxiv - Immunology 2021Quote: ... cells were washed with phenol-free basal media (Agilent) and exposed to 150µL of assay media ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli TG1 cells (Agilent Technologies Japan, Ltd., Tokyo, Japan) were transformed with the ligated plasmids under chilled conditions (Bio-Rad Laboratories ...
-
bioRxiv - Biophysics 2019Quote: ... Following protein expression in BL21 (DE3) RIPL cells (Agilent), protein was purified by immobilized metal-affinity chromatography (IMAC ...
-
bioRxiv - Cancer Biology 2019Quote: ... and transformed into electrocompetent SURE 2 cells (Agilent, #200152). Transformants were inoculated into 500 ml of 2xYT media containing 100 μg/ml carbenicillin and incubated overnight at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... was purified from BL21-DE3 RIPL cells (Stratagene 230280) as previously described (Khokhlatchev et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... For transformation into XL10-Gold ultracompetent cells (Agilent Technologies) the Gibson Assembly was diluted 1:4 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and propagated in E.coli XL 10 Gold cells (Agilent). All cassettes contain Kozak sequences ...