Labshake search
Citations for Agilent :
101 - 150 of 5997 citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... The PCR product fragment sizes were assessed using an Agilent High Sensitivity DNA Kit (Agilent, 5067-4626) on a Agilent 2100 Bioanalyzer ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PCR product was then purified and transcribed using the RNA MAXX In Vitro Transcription Kit (Agilent) to produce the sgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA for E111V variant was obtained by PCR using QuikChange II Site-Directed Mutagenesis kit (Agilent) as described in ref ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplicons were generated using the Agilent Herculase II Fusion Polymerase with dNTPs Combo Kit (Agilent, #600677). In brief ...
-
bioRxiv - Cell Biology 2023Quote: ... CXCR4 mutants were generated by PCR using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) with full-length CXCR4-AcGFP serving as a template and specific primers (Supplementary Table 2).
-
bioRxiv - Synthetic Biology 2024Quote: The SrIRED gene was amplified with error-prone PCR using the GeneMorph II random mutagenesis kit (Agilent) following the instructions of the manufacturer using 2.4 µg template plasmid and 25 PCR cycles ...
-
bioRxiv - Biophysics 2021Quote: The error-prone PCR reaction for libraries “SH3_EP” was done using the GeneMorph II Mutagenesis Kit (Agilent Technologies) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Bands were excised and purified for cloning with the StrataClone PCR Cloning kit (#240205, Agilent, Santa Clara, CA), following manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations were introduced using standard PCR or using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent, 210515). Double A3H fusion constructs I-I ...
-
bioRxiv - Biophysics 2021Quote: ... and L207W mutations were generated by performing site-directed mutagenesis PCR using Quik Change II Mutagenesis Kit (Agilent) with the following primers:
-
bioRxiv - Synthetic Biology 2020Quote: ... The assembly products were then re-purified using the Monarch PCR & DNA Cleanup Kit and quantified by Agilent Bioanalyzer (DNA 1000).
-
bioRxiv - Immunology 2020Quote: cDNA was synthesized by using the AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, US) using extracted RNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Libraries were quantified by quantitative RT-PCR using Agilent qPCR Library Quantification Kit and a MX3005P instrument (Agilent) and relative volumes were pooled accordingly ...
-
bioRxiv - Immunology 2021Quote: ... RACE products were subjected to gel-purification and sub-cloned using the Strataclone UA PCR cloning kit (Agilent). Insert sequences were determined by Sanger sequencing (Seqlab GmbH).
-
bioRxiv - Developmental Biology 2022Quote: ... PCR products were cloned into StrataClone PCR Cloning vector (Agilent, #240205), linearized with XbaI restriction enzyme (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was carried out in the Aria-MX real-time PCR system (Agilent Technologies). The transcript abundance was measured in 10 µL volume of the SYBR Green PCR Master Mix (Takara ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We produced the promoter inserts by performing error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). We used the plasmid constructs with MG1655 promoter variants cloned into them as template DNA for the error-prone PCR aiming to achieve approximately 1.5 SNPs per promoter sequence ...
-
bioRxiv - Developmental Biology 2019Quote: ... Arg-177-Ala mutants were generated in pCR II-TOPO TA vector using QuikChange site directed mutagenesis kit (Agilent). The wild type and the respective modifications were confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were cleaned up with SPRIselect beads and quantified using Qubit dsDNA HS assay kit (Agilent Technologies). The libraries were sequenced on a HiSeq2500 with paired-end 50-bp reads (Illumina).
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random nonamer primers ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We produced the promoter inserts by performing error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). We used 25 ng of the plasmid construct with the MG1655 lacZ promoter variant cloned into it as a template DNA for the error-prone PCR to achieve approximately 1.5 SNPs per variant sequence ...
-
bioRxiv - Genomics 2022Quote: ... The bisulfite-converted library was PCR amplified and indexed using the SureSelect XT Mouse Methyl-Seq Kit (Agilent, #G9651A). Prepared libraries were run on an Illumina sequencing platform using a NextSeq High 150 bp paired-end mode.
-
bioRxiv - Evolutionary Biology 2022Quote: ... PKR site-specific mutants and epteK3Δ227-508 were generated by PCR mutagenesis using the QuickChange Lightning mutagenesis kit (Agilent) and primers holding the desired mutations/deletions ...
-
bioRxiv - Neuroscience 2019Quote: ... Extracted RNA genomes were converted to complementary DNA using an AccuScript PfuUltra II RT-PCR kit (Agilent Technologies, USA) at 42°C for 2 hours with the following barcoded primer annealing to the rabies virus leader sequence ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real-time quantitative PCR (qPCR) was carried out on a Stratagene Mx3005p with Brilliant III SYBR Green kits (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... P190RhoGAP-A mutants were produced through PCR-based site-directed mutagenesis using the Quikchange kit (Stratagene, San Diego, CA). For the Y1087F mutation ...
-
bioRxiv - Immunology 2020Quote: ... and subsequently mutagenized by error-prone PCR (ePCR) via the GeneMorph II Random Mutagenesis Kit (Agilent Technologies, Cat # 200550) with a target nucleotide mutation frequency of 0–4.5 mutations per kilobase of DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purified PCR products were quantified using Agilent Bioanalyzer 2100 Instrument using the High sensitivity DNA Kit (Agilent, 5067-4626). Ion Torrent Emulsion PCR and enrichment steps were performed using Ion PGM HiQ View OT2 kit (Life technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were detected by polyacrylamide gene electrophoresis or the Agilent DNA 1000 kit (Agilent Technologies Inc, Germany). Samples from the Innsbruck cohort and the remaining non-HPV16/18 samples from the Oslo cohort (n=40 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting fragments were cloned into the StrataClone TA-cloning vector and transformed into StrataClone SoloPack competent cells according to the manufacturer’s protocol (StrataClone PCR Cloning Kit, Agilent), resulting in pFF-162 (SpoY) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were assessed for purity and concentration on the Bioanalyzer using the High Sensitivity DNA Kit (Agilent Technologies). Samples were multiplexed and sequenced on the Illumina HiSeq 2500 system (Genome Technology Core ...
-
bioRxiv - Bioengineering 2024Quote: ... Error-prone PCR reactions were carried out following the protocol provided by GeneMorph II Random Mutagenesis Kit (200550, Agilent). Primers were designed to flank residue 1 to 119 of the binder ...
-
bioRxiv - Cell Biology 2019Quote: ... and a real-time PCR system (AriaMax Real PCR System, Agilent Technologies). A list of primers is provided in Supplementary Table 2.
-
bioRxiv - Evolutionary Biology 2022Quote: ... The PCR reaction was performed using Brilliant PCR mix (Agilent Technologies, USA). The standard curve was drawn using serially diluted ΔintS genomic DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and the PCR product was subcloned into Strataclone blunt PCR vectors (Stratagene) and subcloned further into pCM V-ONCM to generate the pCMV-SS-ONCM construct ...
-
bioRxiv - Cell Biology 2021Quote: ... Hsc70D10N was generated by PCR-based site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). Cyclin D1 KO was conducted by CRISPR/Cas9 genome editing (Xie et al. ...
-
bioRxiv - Cell Biology 2020Quote: A library encoding ARHGAP36 isoform 2 mutants was created via error-prone PCR (epPCR) using the GeneMorph II Random Mutagenesis Kit (Agilent). To determine the optimal epPCR conditions for library generation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA probes were synthetized by cloning the DNA amplified region in the Strataclone PCR Cloning Kit (240205-5, Agilent Technologies) (hoxd12a ...
-
bioRxiv - Genomics 2020Quote: ... the amplified libraries were purified using a Qiagen MinElute PCR Purification Kit and eluted in 20 μl Elution Buffer before quantitation on an Agilent 4200 TapeStation (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Developmental Biology 2019Quote: Pkin-29::kin-29SER517ALA was generated by modifying Pkin-29::kin-29cDNA using PCR-based mutagenesis (Quickchange II XL site-directed mutagenesis kit, Stratagene). The following primers were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... the gene of FASTD71V,P73T was randomly mutagenized by error-prone PCR using the GeneMorph II Random Mutagenesis Kit (Agilent). The PCR product was digested with NheI and BamHI ...
-
bioRxiv - Cell Biology 2019Quote: ... Single-point mutants in PACRG were generated by PCR mutagenesis using the QuickChange II Site Directed Mutagenesis kit (Agilent Technologies). The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397 ...
-
bioRxiv - Biochemistry 2020Quote: ... The error-prone PCR (epPCR) library of the gene encoding qmLC/A was created with the GeneMorph II kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: Mutations were generated in previously-described single-round plasmid derivatives of HIV-1NL4-3 (pNLdE-luc)48 and HIV-1LAI (pBru3ori-ΔEnv-luc2)49 that encoded for luciferase via the QuikChange site-directed PCR mutagenesis kit (Agilent). Resulting plasmid DNAs were verified by Sanger sequencing ...
-
bioRxiv - Biophysics 2022Quote: ... pcDNA3-Src K5R/K7R/K9R (Src 3R) mutants were obtained by PCR using the QuickChange Site-Directed Mutagenesis Kit (Stratagene); forward 5’:CCCTTCACCATGGGTAGCAACAGGAGCAGGCCCAGGGATGCCAGCCAGCGGCGCCGC ...
-
bioRxiv - Genomics 2022Quote: ... The library was amplified using 8 PCR cycles and verified on a Fragment Analyzer using the HS NGS fragment kit (Agilent). The library was quantified by qPCR using the KAPA Library quantification kit (Roche ...
-
bioRxiv - Plant Biology 2021Quote: ... Final libraries were amplified with 17 cycles of PCR and assessed on the Bioanalyzer with the High Sensitivity DNA kit (Agilent). All root tissue libraries that were sequenced comprised two biological replicates.
-
bioRxiv - Microbiology 2019Quote: ... We used pMotB.com plasmid as the PCR template for these substitutions using a site-directed mutagenesis kit (QuikChange, Stratagene Inc.) yielding plasmids MotB(D24E ...
-
bioRxiv - Cancer Biology 2019Quote: Both types of libraries ligation products were enriched with 15 PCR cycles and the final library was validated on an Agilent 2100 Bioanalyzer with the Agilent DNA 1000 Kit (Agilent).
-
bioRxiv - Genomics 2019Quote: ... a double-stranded DNA probe (obtained by PCR amplification using oligonucleotides AMO2002-2003) was 32P-labelled using the Prime-It II Random Primer Labeling Kit (Agilent), then hybridized overnight at 65°C in PerfectHyb™ Plus Hybridization Buffer (Sigma).